FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635650_at:

>probe:Drosophila_2:1635650_at:471:549; Interrogation_Position=194; Antisense; GGAGGTACTTCATCAACCTATCGCT
>probe:Drosophila_2:1635650_at:437:645; Interrogation_Position=218; Antisense; TCTTCACCGATCAACTGCATACTTT
>probe:Drosophila_2:1635650_at:594:345; Interrogation_Position=234; Antisense; GCATACTTTCATCCAGAGCACTCTG
>probe:Drosophila_2:1635650_at:299:169; Interrogation_Position=277; Antisense; AAATGGAGCACCATCTTTCTGGCCA
>probe:Drosophila_2:1635650_at:13:189; Interrogation_Position=303; Antisense; AACACCTCATAGCTTCACGTACTAT
>probe:Drosophila_2:1635650_at:438:445; Interrogation_Position=342; Antisense; GATGAAACCCATCCTGACATTCTCA
>probe:Drosophila_2:1635650_at:96:3; Interrogation_Position=360; Antisense; ATTCTCACCCATGATCAAGTCGACT
>probe:Drosophila_2:1635650_at:672:557; Interrogation_Position=421; Antisense; GGACATCCGCCCATGATAAACAATT
>probe:Drosophila_2:1635650_at:289:579; Interrogation_Position=449; Antisense; GGCCATCAAGGTCAAGTTCAGTAGC
>probe:Drosophila_2:1635650_at:5:1; Interrogation_Position=564; Antisense; TAACCTTTCCCGAGTACTATTGGCT
>probe:Drosophila_2:1635650_at:588:63; Interrogation_Position=593; Antisense; ATGTGTCCATAACACTGCACCTTTG
>probe:Drosophila_2:1635650_at:267:615; Interrogation_Position=608; Antisense; TGCACCTTTGCACCTTGGAATGTGT
>probe:Drosophila_2:1635650_at:600:9; Interrogation_Position=652; Antisense; ATTCGCAGTCACATGGAGGGCTTAA
>probe:Drosophila_2:1635650_at:644:5; Interrogation_Position=720; Antisense; ATTGATCATTATCTATGGCCGCTGA

Paste this into a BLAST search page for me
GGAGGTACTTCATCAACCTATCGCTTCTTCACCGATCAACTGCATACTTTGCATACTTTCATCCAGAGCACTCTGAAATGGAGCACCATCTTTCTGGCCAAACACCTCATAGCTTCACGTACTATGATGAAACCCATCCTGACATTCTCAATTCTCACCCATGATCAAGTCGACTGGACATCCGCCCATGATAAACAATTGGCCATCAAGGTCAAGTTCAGTAGCTAACCTTTCCCGAGTACTATTGGCTATGTGTCCATAACACTGCACCTTTGTGCACCTTTGCACCTTGGAATGTGTATTCGCAGTCACATGGAGGGCTTAAATTGATCATTATCTATGGCCGCTGA

Full Affymetrix probeset data:

Annotations for 1635650_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720