FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635651_at:

>probe:Drosophila_2:1635651_at:370:545; Interrogation_Position=127; Antisense; GGATCCGTTGTCCTTCGTGTGAGAA
>probe:Drosophila_2:1635651_at:212:89; Interrogation_Position=13; Antisense; AGTCACCGATCGTTCTCGCTGGAAC
>probe:Drosophila_2:1635651_at:62:197; Interrogation_Position=172; Antisense; AACTGGAGTTGGTCACTTGCCTGCA
>probe:Drosophila_2:1635651_at:695:489; Interrogation_Position=223; Antisense; GTAAAAAATGGTCTGGCCGCCAGGA
>probe:Drosophila_2:1635651_at:610:319; Interrogation_Position=238; Antisense; GCCGCCAGGACATCAATCACTATTG
>probe:Drosophila_2:1635651_at:64:33; Interrogation_Position=253; Antisense; ATCACTATTGTTCACACTGCGGTTG
>probe:Drosophila_2:1635651_at:223:157; Interrogation_Position=266; Antisense; ACACTGCGGTTGCTTCATTGGAAGA
>probe:Drosophila_2:1635651_at:672:51; Interrogation_Position=317; Antisense; ATGCATTTCGAGATCAGCCCGTAAA
>probe:Drosophila_2:1635651_at:621:585; Interrogation_Position=32; Antisense; TGGAACTCGCATCATGACCGTGGAC
>probe:Drosophila_2:1635651_at:411:331; Interrogation_Position=345; Antisense; GCGGCCGTGGATGATATGACCCTGA
>probe:Drosophila_2:1635651_at:501:457; Interrogation_Position=357; Antisense; GATATGACCCTGAAGACACGACCCA
>probe:Drosophila_2:1635651_at:372:399; Interrogation_Position=371; Antisense; GACACGACCCAAGGATTGCGCTGAA
>probe:Drosophila_2:1635651_at:404:381; Interrogation_Position=57; Antisense; GAACCGCAGATTGTGGCCATCATTG
>probe:Drosophila_2:1635651_at:643:35; Interrogation_Position=75; Antisense; ATCATTGTCAGCCACAAGCCACAAG

Paste this into a BLAST search page for me
GGATCCGTTGTCCTTCGTGTGAGAAAGTCACCGATCGTTCTCGCTGGAACAACTGGAGTTGGTCACTTGCCTGCAGTAAAAAATGGTCTGGCCGCCAGGAGCCGCCAGGACATCAATCACTATTGATCACTATTGTTCACACTGCGGTTGACACTGCGGTTGCTTCATTGGAAGAATGCATTTCGAGATCAGCCCGTAAATGGAACTCGCATCATGACCGTGGACGCGGCCGTGGATGATATGACCCTGAGATATGACCCTGAAGACACGACCCAGACACGACCCAAGGATTGCGCTGAAGAACCGCAGATTGTGGCCATCATTGATCATTGTCAGCCACAAGCCACAAG

Full Affymetrix probeset data:

Annotations for 1635651_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720