Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635652_at:

>probe:Drosophila_2:1635652_at:722:651; Interrogation_Position=10004; Antisense; TCAAGTGCATTGCTCTGGATCCGCA
>probe:Drosophila_2:1635652_at:108:139; Interrogation_Position=10028; Antisense; ACGAGGAGTTCTTTGTCACTGGCTC
>probe:Drosophila_2:1635652_at:561:259; Interrogation_Position=10044; Antisense; CACTGGCTCCATTGAGGGTGACATT
>probe:Drosophila_2:1635652_at:653:469; Interrogation_Position=10089; Antisense; GTTCATGCTGATCAATACGTTCCCG
>probe:Drosophila_2:1635652_at:413:463; Interrogation_Position=10133; Antisense; GATTCTTTAAGCACACTGGCCAGGG
>probe:Drosophila_2:1635652_at:33:269; Interrogation_Position=10165; Antisense; CAGGTGTACGTGGATGCCTTCGGAC
>probe:Drosophila_2:1635652_at:149:295; Interrogation_Position=10209; Antisense; CGATGGCTGCATGAAGGTCCGTCTG
>probe:Drosophila_2:1635652_at:547:105; Interrogation_Position=10245; Antisense; AGACAACATTGTTCACTCCGTGTAT
>probe:Drosophila_2:1635652_at:492:11; Interrogation_Position=10280; Antisense; ATTCTATCCGTTACATTTCTGGCGC
>probe:Drosophila_2:1635652_at:506:583; Interrogation_Position=9770; Antisense; TGGCTAGCGCTGGTCAAAGTTCCGA
>probe:Drosophila_2:1635652_at:258:181; Interrogation_Position=9835; Antisense; AAAAAGTCCTGTGTATCGGCCTTCA
>probe:Drosophila_2:1635652_at:52:81; Interrogation_Position=9908; Antisense; AGGTGCTCATCTCGTGCGGCAAACG
>probe:Drosophila_2:1635652_at:228:201; Interrogation_Position=9929; Antisense; AACGCGGCGATGTTTGCGTCTTCGA
>probe:Drosophila_2:1635652_at:292:597; Interrogation_Position=9954; Antisense; TGTGAGACAACGTACGCTGCGTCAT

Paste this into a BLAST search page for me
TCAAGTGCATTGCTCTGGATCCGCAACGAGGAGTTCTTTGTCACTGGCTCCACTGGCTCCATTGAGGGTGACATTGTTCATGCTGATCAATACGTTCCCGGATTCTTTAAGCACACTGGCCAGGGCAGGTGTACGTGGATGCCTTCGGACCGATGGCTGCATGAAGGTCCGTCTGAGACAACATTGTTCACTCCGTGTATATTCTATCCGTTACATTTCTGGCGCTGGCTAGCGCTGGTCAAAGTTCCGAAAAAAGTCCTGTGTATCGGCCTTCAAGGTGCTCATCTCGTGCGGCAAACGAACGCGGCGATGTTTGCGTCTTCGATGTGAGACAACGTACGCTGCGTCAT

Full Affymetrix probeset data:

Annotations for 1635652_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime