FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635654_at:

>probe:Drosophila_2:1635654_at:526:19; Interrogation_Position=1010; Antisense; ATTTGCCCTGCGTCATGTGATCAAC
>probe:Drosophila_2:1635654_at:599:201; Interrogation_Position=1032; Antisense; AACCTGTCGTCGGATCTGCTGGATG
>probe:Drosophila_2:1635654_at:58:461; Interrogation_Position=1062; Antisense; GATTTCTACTGGGACCGCGAGGAAC
>probe:Drosophila_2:1635654_at:111:563; Interrogation_Position=1082; Antisense; GGAACTGGAGGCACTCTACCTGCAG
>probe:Drosophila_2:1635654_at:26:593; Interrogation_Position=1186; Antisense; TGGTGTCCCACAATCTGAACGATGC
>probe:Drosophila_2:1635654_at:96:81; Interrogation_Position=1258; Antisense; AGGTGGGCTTCGAAGTGCTGCACTT
>probe:Drosophila_2:1635654_at:112:149; Interrogation_Position=1279; Antisense; ACTTCGTCAGCGATCACAGTGATTC
>probe:Drosophila_2:1635654_at:607:31; Interrogation_Position=1306; Antisense; ATAAGCTAGAGGTCCTGCCACTGGC
>probe:Drosophila_2:1635654_at:287:317; Interrogation_Position=1341; Antisense; GCCTCGATTCCCAATTAGCAAGTAG
>probe:Drosophila_2:1635654_at:462:657; Interrogation_Position=845; Antisense; TAAGTACACCTTCTCCAATGCGATG
>probe:Drosophila_2:1635654_at:195:547; Interrogation_Position=896; Antisense; GGAGGCGACACTGGACCGCTACATA
>probe:Drosophila_2:1635654_at:238:677; Interrogation_Position=919; Antisense; TAGACTCCATAGAGCATCTCACCGA
>probe:Drosophila_2:1635654_at:704:459; Interrogation_Position=964; Antisense; GATTAAGAATCTCGCGGGCGGCCAT
>probe:Drosophila_2:1635654_at:240:175; Interrogation_Position=997; Antisense; AAACCGGTGAATTATTTGCCCTGCG

Paste this into a BLAST search page for me
ATTTGCCCTGCGTCATGTGATCAACAACCTGTCGTCGGATCTGCTGGATGGATTTCTACTGGGACCGCGAGGAACGGAACTGGAGGCACTCTACCTGCAGTGGTGTCCCACAATCTGAACGATGCAGGTGGGCTTCGAAGTGCTGCACTTACTTCGTCAGCGATCACAGTGATTCATAAGCTAGAGGTCCTGCCACTGGCGCCTCGATTCCCAATTAGCAAGTAGTAAGTACACCTTCTCCAATGCGATGGGAGGCGACACTGGACCGCTACATATAGACTCCATAGAGCATCTCACCGAGATTAAGAATCTCGCGGGCGGCCATAAACCGGTGAATTATTTGCCCTGCG

Full Affymetrix probeset data:

Annotations for 1635654_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720