FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635655_at:

>probe:Drosophila_2:1635655_at:446:593; Interrogation_Position=1941; Antisense; TGTGAGTGTCCATCGGGCGACTGTC
>probe:Drosophila_2:1635655_at:547:493; Interrogation_Position=1963; Antisense; GTCACTGCGACAGCTTTGCGGCGTA
>probe:Drosophila_2:1635655_at:298:627; Interrogation_Position=2020; Antisense; TGCCGGACTGGAGGAGCGCTACCAA
>probe:Drosophila_2:1635655_at:118:49; Interrogation_Position=2068; Antisense; ATGCCACGTTGTCCAGCTTCAAGGG
>probe:Drosophila_2:1635655_at:605:221; Interrogation_Position=2088; Antisense; AAGGGCAACCAGTTCTACGGTGATC
>probe:Drosophila_2:1635655_at:168:513; Interrogation_Position=2107; Antisense; GTGATCCCAGCTTCAGCCGAATGAA
>probe:Drosophila_2:1635655_at:5:501; Interrogation_Position=2134; Antisense; GTCGGCGACAGAAGAACCACCAGCT
>probe:Drosophila_2:1635655_at:552:263; Interrogation_Position=2184; Antisense; CAGCAGCGGAGCAAACAGGGCCAAA
>probe:Drosophila_2:1635655_at:555:579; Interrogation_Position=2228; Antisense; TGGCCACAACCAGCTGGACAGGCAG
>probe:Drosophila_2:1635655_at:392:565; Interrogation_Position=2248; Antisense; GGCAGGGCCACAACGGTCTGGACAA
>probe:Drosophila_2:1635655_at:320:429; Interrogation_Position=2289; Antisense; GAGTTCATCCTGAAGCATGTGCCCA
>probe:Drosophila_2:1635655_at:707:705; Interrogation_Position=2398; Antisense; TTAGTTACTACTCGCACACACTTAC
>probe:Drosophila_2:1635655_at:95:149; Interrogation_Position=2417; Antisense; ACTTACATTCATGAGCACGCCCATT
>probe:Drosophila_2:1635655_at:654:577; Interrogation_Position=2467; Antisense; GGCCGCAATCCATAGCATACTTTTA

Paste this into a BLAST search page for me
TGTGAGTGTCCATCGGGCGACTGTCGTCACTGCGACAGCTTTGCGGCGTATGCCGGACTGGAGGAGCGCTACCAAATGCCACGTTGTCCAGCTTCAAGGGAAGGGCAACCAGTTCTACGGTGATCGTGATCCCAGCTTCAGCCGAATGAAGTCGGCGACAGAAGAACCACCAGCTCAGCAGCGGAGCAAACAGGGCCAAATGGCCACAACCAGCTGGACAGGCAGGGCAGGGCCACAACGGTCTGGACAAGAGTTCATCCTGAAGCATGTGCCCATTAGTTACTACTCGCACACACTTACACTTACATTCATGAGCACGCCCATTGGCCGCAATCCATAGCATACTTTTA

Full Affymetrix probeset data:

Annotations for 1635655_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720