Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635657_s_at:

>probe:Drosophila_2:1635657_s_at:422:619; Interrogation_Position=1097; Antisense; TGCTAATCACATCATCGCCAACGAA
>probe:Drosophila_2:1635657_s_at:260:93; Interrogation_Position=1144; Antisense; AGTTCACAGCCGGAATCGAGCAGCA
>probe:Drosophila_2:1635657_s_at:624:113; Interrogation_Position=1162; Antisense; AGCAGCACGGCCATTTGTTGTGGTC
>probe:Drosophila_2:1635657_s_at:332:357; Interrogation_Position=1224; Antisense; GCACACGGTACCGAATGTTTCGCTG
>probe:Drosophila_2:1635657_s_at:106:61; Interrogation_Position=1238; Antisense; ATGTTTCGCTGAAGCAGCTGCGCGA
>probe:Drosophila_2:1635657_s_at:563:563; Interrogation_Position=1276; Antisense; GGAATCGCGGGCATTGCAGCCGACT
>probe:Drosophila_2:1635657_s_at:342:405; Interrogation_Position=1297; Antisense; GACTCTCTGCGGATCAACGGTGGCA
>probe:Drosophila_2:1635657_s_at:25:527; Interrogation_Position=765; Antisense; GGGCACCTCATCATATCAGAATCTG
>probe:Drosophila_2:1635657_s_at:19:265; Interrogation_Position=781; Antisense; CAGAATCTGGCATCGAGCATACCGC
>probe:Drosophila_2:1635657_s_at:3:83; Interrogation_Position=826; Antisense; AGGGCGTGCCGCAATTGCAGTCGAC
>probe:Drosophila_2:1635657_s_at:152:317; Interrogation_Position=889; Antisense; GCCTCCCGCGACAGTGTGAAAAGTG
>probe:Drosophila_2:1635657_s_at:3:171; Interrogation_Position=908; Antisense; AAAGTGCCTTCCAGCAGGGCAATCT
>probe:Drosophila_2:1635657_s_at:696:81; Interrogation_Position=923; Antisense; AGGGCAATCTTAGCGGCTCCATGGC
>probe:Drosophila_2:1635657_s_at:705:335; Interrogation_Position=938; Antisense; GCTCCATGGCCATTTGCATATCGAA

Paste this into a BLAST search page for me
TGCTAATCACATCATCGCCAACGAAAGTTCACAGCCGGAATCGAGCAGCAAGCAGCACGGCCATTTGTTGTGGTCGCACACGGTACCGAATGTTTCGCTGATGTTTCGCTGAAGCAGCTGCGCGAGGAATCGCGGGCATTGCAGCCGACTGACTCTCTGCGGATCAACGGTGGCAGGGCACCTCATCATATCAGAATCTGCAGAATCTGGCATCGAGCATACCGCAGGGCGTGCCGCAATTGCAGTCGACGCCTCCCGCGACAGTGTGAAAAGTGAAAGTGCCTTCCAGCAGGGCAATCTAGGGCAATCTTAGCGGCTCCATGGCGCTCCATGGCCATTTGCATATCGAA

Full Affymetrix probeset data:

Annotations for 1635657_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime