FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635658_at:

>probe:Drosophila_2:1635658_at:384:213; Interrogation_Position=169; Antisense; AAGACCTCGGGTTTGGATGACCACA
>probe:Drosophila_2:1635658_at:43:347; Interrogation_Position=204; Antisense; GCATGCCCTATACGCCATTTTGGGA
>probe:Drosophila_2:1635658_at:444:5; Interrogation_Position=220; Antisense; ATTTTGGGACTGTTTCTATGCGTGG
>probe:Drosophila_2:1635658_at:571:615; Interrogation_Position=246; Antisense; TGAATCTCTGTTGGTATGCCACTCC
>probe:Drosophila_2:1635658_at:133:573; Interrogation_Position=302; Antisense; GGCTCAACCTTCTGCACATGGTATT
>probe:Drosophila_2:1635658_at:577:415; Interrogation_Position=397; Antisense; GAGCCGCACTTTAATTCCAAACATG
>probe:Drosophila_2:1635658_at:311:691; Interrogation_Position=435; Antisense; TTTGGGATTCCTGCTTATCGCTGGG
>probe:Drosophila_2:1635658_at:101:497; Interrogation_Position=511; Antisense; GTCATCCACCGATTGATGGGCTTGT
>probe:Drosophila_2:1635658_at:567:279; Interrogation_Position=574; Antisense; CTCAATTTGGGATTCGCACGACGGG
>probe:Drosophila_2:1635658_at:127:663; Interrogation_Position=618; Antisense; TAAAAGGCTCAGGATCTCCACGCTG
>probe:Drosophila_2:1635658_at:608:645; Interrogation_Position=655; Antisense; TCAGTGGTTAGCTACGAGTTCCTCT
>probe:Drosophila_2:1635658_at:686:93; Interrogation_Position=671; Antisense; AGTTCCTCTGCCTCTGTAGAGACAT
>probe:Drosophila_2:1635658_at:513:101; Interrogation_Position=688; Antisense; AGAGACATTGTCCATTTGCTACCCA
>probe:Drosophila_2:1635658_at:619:19; Interrogation_Position=701; Antisense; ATTTGCTACCCAACAGCTGGTTCAA

Paste this into a BLAST search page for me
AAGACCTCGGGTTTGGATGACCACAGCATGCCCTATACGCCATTTTGGGAATTTTGGGACTGTTTCTATGCGTGGTGAATCTCTGTTGGTATGCCACTCCGGCTCAACCTTCTGCACATGGTATTGAGCCGCACTTTAATTCCAAACATGTTTGGGATTCCTGCTTATCGCTGGGGTCATCCACCGATTGATGGGCTTGTCTCAATTTGGGATTCGCACGACGGGTAAAAGGCTCAGGATCTCCACGCTGTCAGTGGTTAGCTACGAGTTCCTCTAGTTCCTCTGCCTCTGTAGAGACATAGAGACATTGTCCATTTGCTACCCAATTTGCTACCCAACAGCTGGTTCAA

Full Affymetrix probeset data:

Annotations for 1635658_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720