FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635659_at:

>probe:Drosophila_2:1635659_at:280:83; Interrogation_Position=1762; Antisense; AGTGTGGATGTCGTTTGCCAAGTTC
>probe:Drosophila_2:1635659_at:127:627; Interrogation_Position=1777; Antisense; TGCCAAGTTCGAGATGGGCCTCAGC
>probe:Drosophila_2:1635659_at:707:95; Interrogation_Position=1872; Antisense; AGATGTTGCGTCAGCTGGGAGACAA
>probe:Drosophila_2:1635659_at:146:249; Interrogation_Position=1894; Antisense; CAAGGAGTCGCGTGTTCTGTTGCTA
>probe:Drosophila_2:1635659_at:595:617; Interrogation_Position=1914; Antisense; TGCTAGAGGCATGGCGCGACTTTGA
>probe:Drosophila_2:1635659_at:684:97; Interrogation_Position=2013; Antisense; AGATCGTCTCGGACAATGGCGTCGA
>probe:Drosophila_2:1635659_at:482:435; Interrogation_Position=2051; Antisense; GAGGTATTCGACTACATCTTTCCCG
>probe:Drosophila_2:1635659_at:443:75; Interrogation_Position=2076; Antisense; AGGACGAAATGGCTCGACCCAATCT
>probe:Drosophila_2:1635659_at:707:411; Interrogation_Position=2091; Antisense; GACCCAATCTCAAGTTGCTGGCTGC
>probe:Drosophila_2:1635659_at:616:339; Interrogation_Position=2165; Antisense; GCTACAGCTATTGCATCTGAGCCAG
>probe:Drosophila_2:1635659_at:288:415; Interrogation_Position=2183; Antisense; GAGCCAGAACCTGCAGCTGATGCTG
>probe:Drosophila_2:1635659_at:604:625; Interrogation_Position=2206; Antisense; TGCCCCAGCGGATACGACGGATAGC
>probe:Drosophila_2:1635659_at:26:457; Interrogation_Position=2225; Antisense; GATAGCGGTGACTGATTCACTTCCG
>probe:Drosophila_2:1635659_at:405:13; Interrogation_Position=2239; Antisense; ATTCACTTCCGCCTAAAAATCGTTG

Paste this into a BLAST search page for me
AGTGTGGATGTCGTTTGCCAAGTTCTGCCAAGTTCGAGATGGGCCTCAGCAGATGTTGCGTCAGCTGGGAGACAACAAGGAGTCGCGTGTTCTGTTGCTATGCTAGAGGCATGGCGCGACTTTGAAGATCGTCTCGGACAATGGCGTCGAGAGGTATTCGACTACATCTTTCCCGAGGACGAAATGGCTCGACCCAATCTGACCCAATCTCAAGTTGCTGGCTGCGCTACAGCTATTGCATCTGAGCCAGGAGCCAGAACCTGCAGCTGATGCTGTGCCCCAGCGGATACGACGGATAGCGATAGCGGTGACTGATTCACTTCCGATTCACTTCCGCCTAAAAATCGTTG

Full Affymetrix probeset data:

Annotations for 1635659_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720