FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635661_at:

>probe:Drosophila_2:1635661_at:145:569; Interrogation_Position=375; Antisense; GGCGTTACGTTTCAGCTTGTTTGGA
>probe:Drosophila_2:1635661_at:292:147; Interrogation_Position=463; Antisense; ACTAATCTGCGCACGGGCATCGTTA
>probe:Drosophila_2:1635661_at:85:473; Interrogation_Position=484; Antisense; GTTAAGGCCATCACGGAACAGCTTT
>probe:Drosophila_2:1635661_at:47:411; Interrogation_Position=515; Antisense; GACCATTCGCTTGCGTAAGCTTTTT
>probe:Drosophila_2:1635661_at:427:205; Interrogation_Position=565; Antisense; AAGACCTTTAGTCAGGCCGTGGAAG
>probe:Drosophila_2:1635661_at:171:665; Interrogation_Position=616; Antisense; TACAAGGTCGGCGTATGCATCTGGC
>probe:Drosophila_2:1635661_at:707:683; Interrogation_Position=642; Antisense; TATCCTGCAGACCATTAACTTCTCG
>probe:Drosophila_2:1635661_at:490:709; Interrogation_Position=656; Antisense; TTAACTTCTCGCTGGTGCCGGAACA
>probe:Drosophila_2:1635661_at:636:251; Interrogation_Position=681; Antisense; CAACCGCGTGGTGTTTGTAAGCATT
>probe:Drosophila_2:1635661_at:135:19; Interrogation_Position=703; Antisense; ATTTGCAGCCTGATGTGGACCATTT
>probe:Drosophila_2:1635661_at:399:523; Interrogation_Position=719; Antisense; GGACCATTTTCCTGGCGTACATGAA
>probe:Drosophila_2:1635661_at:107:331; Interrogation_Position=772; Antisense; GCGGTTCTGCCTTGTACATAGTTAC
>probe:Drosophila_2:1635661_at:2:689; Interrogation_Position=805; Antisense; TATTTGTTACCTTTTGTGACTCCCA
>probe:Drosophila_2:1635661_at:499:595; Interrogation_Position=819; Antisense; TGTGACTCCCAATTGTTAGGCCAAT

Paste this into a BLAST search page for me
GGCGTTACGTTTCAGCTTGTTTGGAACTAATCTGCGCACGGGCATCGTTAGTTAAGGCCATCACGGAACAGCTTTGACCATTCGCTTGCGTAAGCTTTTTAAGACCTTTAGTCAGGCCGTGGAAGTACAAGGTCGGCGTATGCATCTGGCTATCCTGCAGACCATTAACTTCTCGTTAACTTCTCGCTGGTGCCGGAACACAACCGCGTGGTGTTTGTAAGCATTATTTGCAGCCTGATGTGGACCATTTGGACCATTTTCCTGGCGTACATGAAGCGGTTCTGCCTTGTACATAGTTACTATTTGTTACCTTTTGTGACTCCCATGTGACTCCCAATTGTTAGGCCAAT

Full Affymetrix probeset data:

Annotations for 1635661_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720