FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635663_at:

>probe:Drosophila_2:1635663_at:435:697; Interrogation_Position=1009; Antisense; TTTCTCTTCGAGATGCTGGCAAAGG
>probe:Drosophila_2:1635663_at:296:249; Interrogation_Position=1099; Antisense; CAATTTATTCTCTTGTTGTCTAGAC
>probe:Drosophila_2:1635663_at:105:499; Interrogation_Position=1116; Antisense; GTCTAGACAATTGTGAGCATCCAAA
>probe:Drosophila_2:1635663_at:596:57; Interrogation_Position=1164; Antisense; ATGTTATGCCGGGTACTGGTGTGTT
>probe:Drosophila_2:1635663_at:169:331; Interrogation_Position=1191; Antisense; GCGGCTCGGAGCACTAGATTTAACT
>probe:Drosophila_2:1635663_at:413:399; Interrogation_Position=1250; Antisense; GACACGCAGCGCTTACAAAAACAAC
>probe:Drosophila_2:1635663_at:435:495; Interrogation_Position=1343; Antisense; GTCACATGCGCGGATAGACCTCAAT
>probe:Drosophila_2:1635663_at:14:457; Interrogation_Position=1355; Antisense; GATAGACCTCAATGGATCCTTCCAG
>probe:Drosophila_2:1635663_at:245:535; Interrogation_Position=1391; Antisense; GGTGACCTCTTTGCCTAACATCATA
>probe:Drosophila_2:1635663_at:138:315; Interrogation_Position=1403; Antisense; GCCTAACATCATACATCTGTGCTTA
>probe:Drosophila_2:1635663_at:312:163; Interrogation_Position=900; Antisense; AAATTGCATTTCCTCAAGGCTGCCT
>probe:Drosophila_2:1635663_at:587:315; Interrogation_Position=921; Antisense; GCCTCCCATTTTTTGTGCATTGTAA
>probe:Drosophila_2:1635663_at:7:231; Interrogation_Position=971; Antisense; AATGTGCTTCAGTGCAGCAGGAACT
>probe:Drosophila_2:1635663_at:210:385; Interrogation_Position=991; Antisense; GAACTAGTGCAGTGTCCGTTTCTCT

Paste this into a BLAST search page for me
TTTCTCTTCGAGATGCTGGCAAAGGCAATTTATTCTCTTGTTGTCTAGACGTCTAGACAATTGTGAGCATCCAAAATGTTATGCCGGGTACTGGTGTGTTGCGGCTCGGAGCACTAGATTTAACTGACACGCAGCGCTTACAAAAACAACGTCACATGCGCGGATAGACCTCAATGATAGACCTCAATGGATCCTTCCAGGGTGACCTCTTTGCCTAACATCATAGCCTAACATCATACATCTGTGCTTAAAATTGCATTTCCTCAAGGCTGCCTGCCTCCCATTTTTTGTGCATTGTAAAATGTGCTTCAGTGCAGCAGGAACTGAACTAGTGCAGTGTCCGTTTCTCT

Full Affymetrix probeset data:

Annotations for 1635663_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720