FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635664_at:

>probe:Drosophila_2:1635664_at:698:609; Interrogation_Position=1010; Antisense; TGACCCGGCACAATCTGGAGAACAT
>probe:Drosophila_2:1635664_at:718:139; Interrogation_Position=1040; Antisense; ACGTGGCCTATCTCGATGTGTGCAA
>probe:Drosophila_2:1635664_at:624:397; Interrogation_Position=1075; Antisense; GACAAGCAGACTGGCGTGTTCCATC
>probe:Drosophila_2:1635664_at:550:603; Interrogation_Position=1091; Antisense; TGTTCCATCCCCTGAATGTGTGGTA
>probe:Drosophila_2:1635664_at:357:213; Interrogation_Position=1120; Antisense; AAGACGCTCGATGCGGCCTTCGAAG
>probe:Drosophila_2:1635664_at:350:361; Interrogation_Position=1160; Antisense; GCAAGTGGAGCGACGCCCTGGATTA
>probe:Drosophila_2:1635664_at:410:197; Interrogation_Position=1190; Antisense; AACGTTTGCTGCCAGGCTTTCGAAA
>probe:Drosophila_2:1635664_at:218:341; Interrogation_Position=1205; Antisense; GCTTTCGAAAATACCACGGACCCTG
>probe:Drosophila_2:1635664_at:469:341; Interrogation_Position=1236; Antisense; GCTATTGGGCCTGCTTCACATGAAG
>probe:Drosophila_2:1635664_at:65:215; Interrogation_Position=1267; Antisense; AAGATTCAGCTCTACGAGGGCCATT
>probe:Drosophila_2:1635664_at:325:73; Interrogation_Position=1298; Antisense; AGGCACTGCACCATCTGGAGGAGGC
>probe:Drosophila_2:1635664_at:145:141; Interrogation_Position=1346; Antisense; ACGGCCGAGATCACAGACTGCTTAC
>probe:Drosophila_2:1635664_at:91:31; Interrogation_Position=1380; Antisense; ATACATGCTCGTTCTACAAGCGCGA
>probe:Drosophila_2:1635664_at:645:197; Interrogation_Position=994; Antisense; AACGAGGCGATGACTCTGACCCGGC

Paste this into a BLAST search page for me
TGACCCGGCACAATCTGGAGAACATACGTGGCCTATCTCGATGTGTGCAAGACAAGCAGACTGGCGTGTTCCATCTGTTCCATCCCCTGAATGTGTGGTAAAGACGCTCGATGCGGCCTTCGAAGGCAAGTGGAGCGACGCCCTGGATTAAACGTTTGCTGCCAGGCTTTCGAAAGCTTTCGAAAATACCACGGACCCTGGCTATTGGGCCTGCTTCACATGAAGAAGATTCAGCTCTACGAGGGCCATTAGGCACTGCACCATCTGGAGGAGGCACGGCCGAGATCACAGACTGCTTACATACATGCTCGTTCTACAAGCGCGAAACGAGGCGATGACTCTGACCCGGC

Full Affymetrix probeset data:

Annotations for 1635664_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720