FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635665_at:

>probe:Drosophila_2:1635665_at:121:331; Interrogation_Position=1723; Antisense; GCGGGCAAGCCACCCATCAAAAAGA
>probe:Drosophila_2:1635665_at:648:127; Interrogation_Position=1753; Antisense; ACCAGGACAAAGTCGCTGCGATTCT
>probe:Drosophila_2:1635665_at:339:115; Interrogation_Position=1789; Antisense; AGCATCTCGCGGGAGCAGTACCAGA
>probe:Drosophila_2:1635665_at:482:487; Interrogation_Position=1806; Antisense; GTACCAGAGCCAGAGCGAGCACCTA
>probe:Drosophila_2:1635665_at:279:637; Interrogation_Position=1856; Antisense; TCGTCGATCCCAAAACTCTTCAGGA
>probe:Drosophila_2:1635665_at:88:185; Interrogation_Position=1889; Antisense; AAAAGGCGGCGGATGACAATGACAG
>probe:Drosophila_2:1635665_at:22:431; Interrogation_Position=1974; Antisense; GAGTAACTGAGCGTCGACCCGAAAA
>probe:Drosophila_2:1635665_at:361:543; Interrogation_Position=2000; Antisense; GGATTTGCGGATTTACCTCTACCTA
>probe:Drosophila_2:1635665_at:54:131; Interrogation_Position=2020; Antisense; ACCTAGTATTAGTTGTCGAGCTGAA
>probe:Drosophila_2:1635665_at:219:73; Interrogation_Position=2048; Antisense; AGGCATGAATCAATCGACTACCGAC
>probe:Drosophila_2:1635665_at:136:405; Interrogation_Position=2063; Antisense; GACTACCGACTAACATTGCTCAGTT
>probe:Drosophila_2:1635665_at:318:485; Interrogation_Position=2117; Antisense; GTAGGACCTTAGTTGTTGCTGAATA
>probe:Drosophila_2:1635665_at:486:19; Interrogation_Position=2165; Antisense; ATTTGCATCTGCTTATACCGTTTAG
>probe:Drosophila_2:1635665_at:191:479; Interrogation_Position=2184; Antisense; GTTTAGCTACCTTAAGTTACTGTCA

Paste this into a BLAST search page for me
GCGGGCAAGCCACCCATCAAAAAGAACCAGGACAAAGTCGCTGCGATTCTAGCATCTCGCGGGAGCAGTACCAGAGTACCAGAGCCAGAGCGAGCACCTATCGTCGATCCCAAAACTCTTCAGGAAAAAGGCGGCGGATGACAATGACAGGAGTAACTGAGCGTCGACCCGAAAAGGATTTGCGGATTTACCTCTACCTAACCTAGTATTAGTTGTCGAGCTGAAAGGCATGAATCAATCGACTACCGACGACTACCGACTAACATTGCTCAGTTGTAGGACCTTAGTTGTTGCTGAATAATTTGCATCTGCTTATACCGTTTAGGTTTAGCTACCTTAAGTTACTGTCA

Full Affymetrix probeset data:

Annotations for 1635665_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720