FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635667_at:

>probe:Drosophila_2:1635667_at:442:239; Interrogation_Position=2869; Antisense; AATCAGTTCTTGATGCACGCCCAGG
>probe:Drosophila_2:1635667_at:463:353; Interrogation_Position=2883; Antisense; GCACGCCCAGGAGTCCGATTTGGAG
>probe:Drosophila_2:1635667_at:35:87; Interrogation_Position=2910; Antisense; AGTGCTGACACTTCACACCAATGTG
>probe:Drosophila_2:1635667_at:700:249; Interrogation_Position=2928; Antisense; CAATGTGACCGGTATCATGCCCTTC
>probe:Drosophila_2:1635667_at:59:51; Interrogation_Position=2944; Antisense; ATGCCCTTCCTGTACAACCGATGTG
>probe:Drosophila_2:1635667_at:574:253; Interrogation_Position=2958; Antisense; CAACCGATGTGGACTGTCAGTGCCA
>probe:Drosophila_2:1635667_at:586:499; Interrogation_Position=3000; Antisense; GTCTGGCTTGCATGGCTTTTTGAGA
>probe:Drosophila_2:1635667_at:399:65; Interrogation_Position=3037; Antisense; ATGGTATCCTCCACTGGCATCAACA
>probe:Drosophila_2:1635667_at:29:571; Interrogation_Position=3052; Antisense; GGCATCAACAGGGAGCTCAGCAAGT
>probe:Drosophila_2:1635667_at:542:109; Interrogation_Position=3107; Antisense; AGAAGGTATTTCTATGAAGCCCGAA
>probe:Drosophila_2:1635667_at:13:245; Interrogation_Position=3164; Antisense; AATTTGTCAAGCTTTTGTCCAGTCA
>probe:Drosophila_2:1635667_at:333:727; Interrogation_Position=3178; Antisense; TTGTCCAGTCATCCTATTGTAGTAA
>probe:Drosophila_2:1635667_at:407:229; Interrogation_Position=3347; Antisense; AATGGTCAAATTTTTCTGCCTACAC
>probe:Drosophila_2:1635667_at:642:641; Interrogation_Position=3361; Antisense; TCTGCCTACACAACTCATAGCTTTA

Paste this into a BLAST search page for me
AATCAGTTCTTGATGCACGCCCAGGGCACGCCCAGGAGTCCGATTTGGAGAGTGCTGACACTTCACACCAATGTGCAATGTGACCGGTATCATGCCCTTCATGCCCTTCCTGTACAACCGATGTGCAACCGATGTGGACTGTCAGTGCCAGTCTGGCTTGCATGGCTTTTTGAGAATGGTATCCTCCACTGGCATCAACAGGCATCAACAGGGAGCTCAGCAAGTAGAAGGTATTTCTATGAAGCCCGAAAATTTGTCAAGCTTTTGTCCAGTCATTGTCCAGTCATCCTATTGTAGTAAAATGGTCAAATTTTTCTGCCTACACTCTGCCTACACAACTCATAGCTTTA

Full Affymetrix probeset data:

Annotations for 1635667_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720