Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635668_at:

>probe:Drosophila_2:1635668_at:153:229; Interrogation_Position=1456; Antisense; AATGGACTGCCATCACACATGAGGA
>probe:Drosophila_2:1635668_at:143:437; Interrogation_Position=1476; Antisense; GAGGAGCTTCACTCGCAAATTTCAG
>probe:Drosophila_2:1635668_at:446:355; Interrogation_Position=1503; Antisense; GCACTGAATTCTTCGTCAGCGGACA
>probe:Drosophila_2:1635668_at:476:479; Interrogation_Position=1531; Antisense; GTATTACGTACAACTCTTACCGCGC
>probe:Drosophila_2:1635668_at:606:365; Interrogation_Position=1597; Antisense; GAATACCGAGTAACTATCCACTGGA
>probe:Drosophila_2:1635668_at:39:561; Interrogation_Position=1619; Antisense; GGAAATGCCTCTATGGATTCTGAAT
>probe:Drosophila_2:1635668_at:496:595; Interrogation_Position=1643; Antisense; TGTGCACTGGAACGGATGCCTTACC
>probe:Drosophila_2:1635668_at:624:353; Interrogation_Position=1771; Antisense; GCACCATCTACAGCTTCGATATATT
>probe:Drosophila_2:1635668_at:165:435; Interrogation_Position=1806; Antisense; GAGGGATCCATGCAAAACACCATTG
>probe:Drosophila_2:1635668_at:270:109; Interrogation_Position=1843; Antisense; AGAAGCCTTACATAAGCGCCTTCGC
>probe:Drosophila_2:1635668_at:277:221; Interrogation_Position=1905; Antisense; AAGGGATCGGTCTACGCGTTCAAGC
>probe:Drosophila_2:1635668_at:385:489; Interrogation_Position=1954; Antisense; GTACAACACAATGCGCCAATGCGGT
>probe:Drosophila_2:1635668_at:35:53; Interrogation_Position=1972; Antisense; ATGCGGTTACTAAACGTTCTCACAG
>probe:Drosophila_2:1635668_at:311:471; Interrogation_Position=1987; Antisense; GTTCTCACAGTTGCGTTTATTACGA

Paste this into a BLAST search page for me
AATGGACTGCCATCACACATGAGGAGAGGAGCTTCACTCGCAAATTTCAGGCACTGAATTCTTCGTCAGCGGACAGTATTACGTACAACTCTTACCGCGCGAATACCGAGTAACTATCCACTGGAGGAAATGCCTCTATGGATTCTGAATTGTGCACTGGAACGGATGCCTTACCGCACCATCTACAGCTTCGATATATTGAGGGATCCATGCAAAACACCATTGAGAAGCCTTACATAAGCGCCTTCGCAAGGGATCGGTCTACGCGTTCAAGCGTACAACACAATGCGCCAATGCGGTATGCGGTTACTAAACGTTCTCACAGGTTCTCACAGTTGCGTTTATTACGA

Full Affymetrix probeset data:

Annotations for 1635668_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime