FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635670_at:

>probe:Drosophila_2:1635670_at:531:371; Interrogation_Position=1037; Antisense; GAAGGCACTTTCTGAGGTACGATTT
>probe:Drosophila_2:1635670_at:283:489; Interrogation_Position=1053; Antisense; GTACGATTTGTGTGCCCAAGAGGCT
>probe:Drosophila_2:1635670_at:549:663; Interrogation_Position=1113; Antisense; TAAAGTCCTGTACCCACGGCAAAGA
>probe:Drosophila_2:1635670_at:153:39; Interrogation_Position=582; Antisense; ATCTACGTGTGGGACCGTGAGCTCA
>probe:Drosophila_2:1635670_at:456:695; Interrogation_Position=632; Antisense; TTTCCCCAGCTGGTTGAATCACGTG
>probe:Drosophila_2:1635670_at:196:539; Interrogation_Position=656; Antisense; GGTACACACGAATGTGGCCCTTTTG
>probe:Drosophila_2:1635670_at:369:579; Interrogation_Position=679; Antisense; TGGCCATTATGGACCTGTTTACCTG
>probe:Drosophila_2:1635670_at:358:47; Interrogation_Position=715; Antisense; ATCCGAGTCGATTGGCAGGCATCAC
>probe:Drosophila_2:1635670_at:153:341; Interrogation_Position=761; Antisense; GCTTTACATCATCTGGCTGCACATT
>probe:Drosophila_2:1635670_at:675:355; Interrogation_Position=779; Antisense; GCACATTGTTCGCTACTTCAGTGGC
>probe:Drosophila_2:1635670_at:108:277; Interrogation_Position=794; Antisense; CTTCAGTGGCGAGTGGGTGTATCCC
>probe:Drosophila_2:1635670_at:589:25; Interrogation_Position=839; Antisense; ATACCTGCGCTACGTGTTCTTGGCA
>probe:Drosophila_2:1635670_at:10:475; Interrogation_Position=875; Antisense; GTTCAACCTGGTTTGCTATCTGCTC
>probe:Drosophila_2:1635670_at:245:529; Interrogation_Position=901; Antisense; GGGAGTTCGCCAACAACGTCGTTTG

Paste this into a BLAST search page for me
GAAGGCACTTTCTGAGGTACGATTTGTACGATTTGTGTGCCCAAGAGGCTTAAAGTCCTGTACCCACGGCAAAGAATCTACGTGTGGGACCGTGAGCTCATTTCCCCAGCTGGTTGAATCACGTGGGTACACACGAATGTGGCCCTTTTGTGGCCATTATGGACCTGTTTACCTGATCCGAGTCGATTGGCAGGCATCACGCTTTACATCATCTGGCTGCACATTGCACATTGTTCGCTACTTCAGTGGCCTTCAGTGGCGAGTGGGTGTATCCCATACCTGCGCTACGTGTTCTTGGCAGTTCAACCTGGTTTGCTATCTGCTCGGGAGTTCGCCAACAACGTCGTTTG

Full Affymetrix probeset data:

Annotations for 1635670_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720