FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635671_at:

>probe:Drosophila_2:1635671_at:322:155; Interrogation_Position=151; Antisense; ACAGCCCTGGAGAACTTTAATGGAG
>probe:Drosophila_2:1635671_at:158:693; Interrogation_Position=176; Antisense; TTTCGGGACCCAAGGATACTACGCA
>probe:Drosophila_2:1635671_at:16:163; Interrogation_Position=206; Antisense; AAATTATCAACCTTCCTTATGGAGC
>probe:Drosophila_2:1635671_at:380:681; Interrogation_Position=223; Antisense; TATGGAGCACCGCAAAGGCCGCCAA
>probe:Drosophila_2:1635671_at:485:311; Interrogation_Position=243; Antisense; GCCAATGGGAGTTCCGCTGGTTCAT
>probe:Drosophila_2:1635671_at:638:431; Interrogation_Position=280; Antisense; GAGGAGTTGTTAGCCTCGTACAGCC
>probe:Drosophila_2:1635671_at:566:493; Interrogation_Position=307; Antisense; GTCAACAACGCTGCTGGATTTCCAG
>probe:Drosophila_2:1635671_at:501:689; Interrogation_Position=33; Antisense; TTTACCCATTGTCACTATCGCTATA
>probe:Drosophila_2:1635671_at:667:95; Interrogation_Position=345; Antisense; AGATAACAGCCGACTTCCCATCGAT
>probe:Drosophila_2:1635671_at:489:677; Interrogation_Position=396; Antisense; TAGATTGAAGCAGCTGCCCGTGGAC
>probe:Drosophila_2:1635671_at:437:321; Interrogation_Position=426; Antisense; GCCCTTCTGGCTTGTGAACTATCAA
>probe:Drosophila_2:1635671_at:613:661; Interrogation_Position=60; Antisense; TAAAATTACCCACGCTCAAAGGCCG
>probe:Drosophila_2:1635671_at:366:257; Interrogation_Position=76; Antisense; CAAAGGCCGTCTTTTGCTGGCATAA
>probe:Drosophila_2:1635671_at:235:569; Interrogation_Position=94; Antisense; GGCATAAGACCTCCAGGCGGACTTA

Paste this into a BLAST search page for me
ACAGCCCTGGAGAACTTTAATGGAGTTTCGGGACCCAAGGATACTACGCAAAATTATCAACCTTCCTTATGGAGCTATGGAGCACCGCAAAGGCCGCCAAGCCAATGGGAGTTCCGCTGGTTCATGAGGAGTTGTTAGCCTCGTACAGCCGTCAACAACGCTGCTGGATTTCCAGTTTACCCATTGTCACTATCGCTATAAGATAACAGCCGACTTCCCATCGATTAGATTGAAGCAGCTGCCCGTGGACGCCCTTCTGGCTTGTGAACTATCAATAAAATTACCCACGCTCAAAGGCCGCAAAGGCCGTCTTTTGCTGGCATAAGGCATAAGACCTCCAGGCGGACTTA

Full Affymetrix probeset data:

Annotations for 1635671_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720