Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635672_at:

>probe:Drosophila_2:1635672_at:253:47; Interrogation_Position=432; Antisense; ATCCGTACTTTGGTAGCCATTTCTA
>probe:Drosophila_2:1635672_at:71:187; Interrogation_Position=461; Antisense; AACAATGGTGTCTGCTTATCGCTGC
>probe:Drosophila_2:1635672_at:643:619; Interrogation_Position=528; Antisense; TGCTGTTCATCCTGGTCAATACGTT
>probe:Drosophila_2:1635672_at:649:27; Interrogation_Position=546; Antisense; ATACGTTGTCACTGATCTTCATCCT
>probe:Drosophila_2:1635672_at:410:47; Interrogation_Position=566; Antisense; ATCCTCTTTTCCTACATTCGAATGT
>probe:Drosophila_2:1635672_at:379:369; Interrogation_Position=618; Antisense; GAATGCGAAGCACTCACAGCGGTCG
>probe:Drosophila_2:1635672_at:309:229; Interrogation_Position=647; Antisense; AATGTGGTAGCAACTCGCTTTGCCA
>probe:Drosophila_2:1635672_at:79:695; Interrogation_Position=665; Antisense; TTTGCCATCATTGTGACCACCGATT
>probe:Drosophila_2:1635672_at:115:573; Interrogation_Position=699; Antisense; GGCTGCCCATAATTGTGGTCAAATT
>probe:Drosophila_2:1635672_at:295:651; Interrogation_Position=717; Antisense; TCAAATTGGCTGCTCTTTCAGGCTG
>probe:Drosophila_2:1635672_at:269:235; Interrogation_Position=806; Antisense; AATCCAGTGCTCTACACATTGACCA
>probe:Drosophila_2:1635672_at:242:709; Interrogation_Position=840; Antisense; TTAAGCAACAGCTGCGTCGCTACTG
>probe:Drosophila_2:1635672_at:403:103; Interrogation_Position=918; Antisense; AGACTGCCTACGAGTCCGGACTGAG
>probe:Drosophila_2:1635672_at:109:599; Interrogation_Position=999; Antisense; TGTCACACCGGCAGATGAGCTATCT

Paste this into a BLAST search page for me
ATCCGTACTTTGGTAGCCATTTCTAAACAATGGTGTCTGCTTATCGCTGCTGCTGTTCATCCTGGTCAATACGTTATACGTTGTCACTGATCTTCATCCTATCCTCTTTTCCTACATTCGAATGTGAATGCGAAGCACTCACAGCGGTCGAATGTGGTAGCAACTCGCTTTGCCATTTGCCATCATTGTGACCACCGATTGGCTGCCCATAATTGTGGTCAAATTTCAAATTGGCTGCTCTTTCAGGCTGAATCCAGTGCTCTACACATTGACCATTAAGCAACAGCTGCGTCGCTACTGAGACTGCCTACGAGTCCGGACTGAGTGTCACACCGGCAGATGAGCTATCT

Full Affymetrix probeset data:

Annotations for 1635672_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime