FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635674_at:

>probe:Drosophila_2:1635674_at:695:717; Interrogation_Position=1012; Antisense; TTCCTGGACACTTTGGGTCGCAAGG
>probe:Drosophila_2:1635674_at:74:317; Interrogation_Position=1052; Antisense; GCCTCCTTGTTATGGCCGGACTAAT
>probe:Drosophila_2:1635674_at:508:189; Interrogation_Position=1126; Antisense; AACTTAATGACCTCAGCCTGCAATA
>probe:Drosophila_2:1635674_at:309:3; Interrogation_Position=1155; Antisense; ATTGGCCTTCCAGGTATTCGCAGGT
>probe:Drosophila_2:1635674_at:365:49; Interrogation_Position=1225; Antisense; ATGCGGGTCAAGTCGTTCCTGGTCG
>probe:Drosophila_2:1635674_at:599:719; Interrogation_Position=1240; Antisense; TTCCTGGTCGGAGTGATTGTCATCA
>probe:Drosophila_2:1635674_at:520:723; Interrogation_Position=1265; Antisense; TTGAGCAGATCGTCCATATCGTGGT
>probe:Drosophila_2:1635674_at:263:655; Interrogation_Position=1289; Antisense; TAATTGCCTGTGTAAGCTCTGTGCC
>probe:Drosophila_2:1635674_at:487:555; Interrogation_Position=1320; Antisense; GGACTTCTTCTTCCAGTATTTTTTG
>probe:Drosophila_2:1635674_at:68:59; Interrogation_Position=1372; Antisense; ATGATCTTCTTTACCGTGTCTATGC
>probe:Drosophila_2:1635674_at:130:57; Interrogation_Position=1411; Antisense; ATGACGCTGAGGAAGGCTGGCCACC
>probe:Drosophila_2:1635674_at:533:225; Interrogation_Position=941; Antisense; AAGGACTCAGTCTTTGGCCAATCTA
>probe:Drosophila_2:1635674_at:182:233; Interrogation_Position=960; Antisense; AATCTACCTATTTGGCGTTCTTCGT
>probe:Drosophila_2:1635674_at:412:229; Interrogation_Position=996; Antisense; AATGGTGGCTTTGATATTCCTGGAC

Paste this into a BLAST search page for me
TTCCTGGACACTTTGGGTCGCAAGGGCCTCCTTGTTATGGCCGGACTAATAACTTAATGACCTCAGCCTGCAATAATTGGCCTTCCAGGTATTCGCAGGTATGCGGGTCAAGTCGTTCCTGGTCGTTCCTGGTCGGAGTGATTGTCATCATTGAGCAGATCGTCCATATCGTGGTTAATTGCCTGTGTAAGCTCTGTGCCGGACTTCTTCTTCCAGTATTTTTTGATGATCTTCTTTACCGTGTCTATGCATGACGCTGAGGAAGGCTGGCCACCAAGGACTCAGTCTTTGGCCAATCTAAATCTACCTATTTGGCGTTCTTCGTAATGGTGGCTTTGATATTCCTGGAC

Full Affymetrix probeset data:

Annotations for 1635674_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720