Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635679_at:

>probe:Drosophila_2:1635679_at:680:163; Interrogation_Position=2202; Antisense; AAATATTGACGCATTTCGTTGTGAT
>probe:Drosophila_2:1635679_at:518:393; Interrogation_Position=2291; Antisense; GAAATCCGTAATCAAACGCTAGCAA
>probe:Drosophila_2:1635679_at:346:77; Interrogation_Position=2328; Antisense; AGGAGTCTAGGTGCCATATTCATTC
>probe:Drosophila_2:1635679_at:377:149; Interrogation_Position=2370; Antisense; ACTTACTCTTACATTTCGCATTGCC
>probe:Drosophila_2:1635679_at:402:7; Interrogation_Position=2389; Antisense; ATTGCCGCAGCTGAAGTTTTTGGAC
>probe:Drosophila_2:1635679_at:218:557; Interrogation_Position=2410; Antisense; GGACTAGCTTAAACTGAACTCAGGG
>probe:Drosophila_2:1635679_at:2:493; Interrogation_Position=2447; Antisense; GTAACTTACTTAAACGCACGCAGAG
>probe:Drosophila_2:1635679_at:728:135; Interrogation_Position=2460; Antisense; ACGCACGCAGAGCAATTGACAAAAT
>probe:Drosophila_2:1635679_at:21:675; Interrogation_Position=2556; Antisense; TAGCTAGTAGAACCCCTAGTTATGT
>probe:Drosophila_2:1635679_at:202:277; Interrogation_Position=2571; Antisense; CTAGTTATGTATATTCCACCCGCCA
>probe:Drosophila_2:1635679_at:349:309; Interrogation_Position=2593; Antisense; CCACCACAACTCGTCTGTAGTATTA
>probe:Drosophila_2:1635679_at:685:115; Interrogation_Position=2620; Antisense; AGCTAAGTTCTAGAATGCCCAAGTT
>probe:Drosophila_2:1635679_at:26:321; Interrogation_Position=2636; Antisense; GCCCAAGTTATTCGTTTTGTGCTTA
>probe:Drosophila_2:1635679_at:519:133; Interrogation_Position=2765; Antisense; ACGAAGCCCGATTGCAAATTGTTAA

Paste this into a BLAST search page for me
AAATATTGACGCATTTCGTTGTGATGAAATCCGTAATCAAACGCTAGCAAAGGAGTCTAGGTGCCATATTCATTCACTTACTCTTACATTTCGCATTGCCATTGCCGCAGCTGAAGTTTTTGGACGGACTAGCTTAAACTGAACTCAGGGGTAACTTACTTAAACGCACGCAGAGACGCACGCAGAGCAATTGACAAAATTAGCTAGTAGAACCCCTAGTTATGTCTAGTTATGTATATTCCACCCGCCACCACCACAACTCGTCTGTAGTATTAAGCTAAGTTCTAGAATGCCCAAGTTGCCCAAGTTATTCGTTTTGTGCTTAACGAAGCCCGATTGCAAATTGTTAA

Full Affymetrix probeset data:

Annotations for 1635679_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime