FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635680_at:

>probe:Drosophila_2:1635680_at:256:567; Interrogation_Position=279; Antisense; GGCAACACTCCGGTGGCACGAGGAA
>probe:Drosophila_2:1635680_at:537:729; Interrogation_Position=313; Antisense; TTGGCCAAGTTTGCCTTGAGGCGTT
>probe:Drosophila_2:1635680_at:154:445; Interrogation_Position=370; Antisense; GATGAGTTCAGCTATGTGTCGTATA
>probe:Drosophila_2:1635680_at:106:451; Interrogation_Position=430; Antisense; GATCCCATATCCGTTTTGGACTTTG
>probe:Drosophila_2:1635680_at:712:709; Interrogation_Position=479; Antisense; TTAAGGGCTGCACGATGGCCCACAT
>probe:Drosophila_2:1635680_at:137:441; Interrogation_Position=526; Antisense; GATGGACAGTGTCGCGGCTACTTCA
>probe:Drosophila_2:1635680_at:284:713; Interrogation_Position=547; Antisense; TTCACCCAGCTGGTCCAAGATTTGG
>probe:Drosophila_2:1635680_at:107:137; Interrogation_Position=613; Antisense; ACGAGCGGACTCTATCAGTACGGTG
>probe:Drosophila_2:1635680_at:41:89; Interrogation_Position=629; Antisense; AGTACGGTGTCCTATGTCACTTTTC
>probe:Drosophila_2:1635680_at:7:149; Interrogation_Position=647; Antisense; ACTTTTCGCGCGGAAAGATCGCCAA
>probe:Drosophila_2:1635680_at:112:251; Interrogation_Position=669; Antisense; CAATGAGCTGGTCTACCGGGCAAGT
>probe:Drosophila_2:1635680_at:450:361; Interrogation_Position=688; Antisense; GCAAGTGCTCATCCGGGAAGTCGCT
>probe:Drosophila_2:1635680_at:316:373; Interrogation_Position=704; Antisense; GAAGTCGCTGCTATGCGGGAACCCA
>probe:Drosophila_2:1635680_at:217:327; Interrogation_Position=718; Antisense; GCGGGAACCCACTCCATATATGAGG

Paste this into a BLAST search page for me
GGCAACACTCCGGTGGCACGAGGAATTGGCCAAGTTTGCCTTGAGGCGTTGATGAGTTCAGCTATGTGTCGTATAGATCCCATATCCGTTTTGGACTTTGTTAAGGGCTGCACGATGGCCCACATGATGGACAGTGTCGCGGCTACTTCATTCACCCAGCTGGTCCAAGATTTGGACGAGCGGACTCTATCAGTACGGTGAGTACGGTGTCCTATGTCACTTTTCACTTTTCGCGCGGAAAGATCGCCAACAATGAGCTGGTCTACCGGGCAAGTGCAAGTGCTCATCCGGGAAGTCGCTGAAGTCGCTGCTATGCGGGAACCCAGCGGGAACCCACTCCATATATGAGG

Full Affymetrix probeset data:

Annotations for 1635680_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720