Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635681_at:

>probe:Drosophila_2:1635681_at:102:605; Interrogation_Position=1413; Antisense; TGATCAGTATGTGCGGTCTTGCCAA
>probe:Drosophila_2:1635681_at:224:163; Interrogation_Position=1444; Antisense; AAATTGTGCGAGTGCTCATCTCTCC
>probe:Drosophila_2:1635681_at:22:689; Interrogation_Position=1513; Antisense; TATTTAGTATCCATAACGACCCGTT
>probe:Drosophila_2:1635681_at:431:27; Interrogation_Position=1525; Antisense; ATAACGACCCGTTTTGGCCATGTGT
>probe:Drosophila_2:1635681_at:386:577; Interrogation_Position=1540; Antisense; GGCCATGTGTTTCTCAAAAGACTTT
>probe:Drosophila_2:1635681_at:206:265; Interrogation_Position=1617; Antisense; GAGAGTTAACGACCTGAACCTTTTG
>probe:Drosophila_2:1635681_at:701:687; Interrogation_Position=1637; Antisense; TTTTGAACACTAGAAGCCCGCCTAT
>probe:Drosophila_2:1635681_at:610:315; Interrogation_Position=1656; Antisense; GCCTATCCCGCATTGCATTATGCAT
>probe:Drosophila_2:1635681_at:621:363; Interrogation_Position=1742; Antisense; GAATTAAGAGGCCATCCGATCCGCG
>probe:Drosophila_2:1635681_at:477:697; Interrogation_Position=1787; Antisense; TTTCATCGCCGAGCTCAGGGACAAA
>probe:Drosophila_2:1635681_at:144:165; Interrogation_Position=1809; Antisense; AAATCGATGTGTTCGCAGATACTGA
>probe:Drosophila_2:1635681_at:61:317; Interrogation_Position=1881; Antisense; GCCTGGCTCGCGATCGGCGGATATA
>probe:Drosophila_2:1635681_at:375:331; Interrogation_Position=1897; Antisense; GCGGATATAGCTTTCGTGTACTACT
>probe:Drosophila_2:1635681_at:536:489; Interrogation_Position=1914; Antisense; GTACTACTCGTATTTATGGTGCAGA

Paste this into a BLAST search page for me
TGATCAGTATGTGCGGTCTTGCCAAAAATTGTGCGAGTGCTCATCTCTCCTATTTAGTATCCATAACGACCCGTTATAACGACCCGTTTTGGCCATGTGTGGCCATGTGTTTCTCAAAAGACTTTGAGAGTTAACGACCTGAACCTTTTGTTTTGAACACTAGAAGCCCGCCTATGCCTATCCCGCATTGCATTATGCATGAATTAAGAGGCCATCCGATCCGCGTTTCATCGCCGAGCTCAGGGACAAAAAATCGATGTGTTCGCAGATACTGAGCCTGGCTCGCGATCGGCGGATATAGCGGATATAGCTTTCGTGTACTACTGTACTACTCGTATTTATGGTGCAGA

Full Affymetrix probeset data:

Annotations for 1635681_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime