FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635682_at:

>probe:Drosophila_2:1635682_at:11:309; Interrogation_Position=420; Antisense; CCATATCACCACCAAGTATTATAGA
>probe:Drosophila_2:1635682_at:552:645; Interrogation_Position=425; Antisense; TCACCACCAAGTATTATAGATTAGG
>probe:Drosophila_2:1635682_at:105:675; Interrogation_Position=441; Antisense; TAGATTAGGTCTATTCCGGCTATTC
>probe:Drosophila_2:1635682_at:302:461; Interrogation_Position=443; Antisense; GATTAGGTCTATTCCGGCTATTCAC
>probe:Drosophila_2:1635682_at:47:15; Interrogation_Position=444; Antisense; ATTAGGTCTATTCCGGCTATTCACA
>probe:Drosophila_2:1635682_at:679:535; Interrogation_Position=448; Antisense; GGTCTATTCCGGCTATTCACATTCA
>probe:Drosophila_2:1635682_at:56:279; Interrogation_Position=451; Antisense; CTATTCCGGCTATTCACATTCACAT
>probe:Drosophila_2:1635682_at:398:13; Interrogation_Position=462; Antisense; ATTCACATTCACATTTTATCTAAAA
>probe:Drosophila_2:1635682_at:116:689; Interrogation_Position=496; Antisense; TATTTATGTTCTACAATATCATTTG
>probe:Drosophila_2:1635682_at:553:461; Interrogation_Position=528; Antisense; GATTAATCTTATCATTCTGCCCATA
>probe:Drosophila_2:1635682_at:631:655; Interrogation_Position=531; Antisense; TAATCTTATCATTCTGCCCATATTG
>probe:Drosophila_2:1635682_at:483:37; Interrogation_Position=533; Antisense; ATCTTATCATTCTGCCCATATTGAA
>probe:Drosophila_2:1635682_at:656:685; Interrogation_Position=537; Antisense; TATCATTCTGCCCATATTGAAAATG
>probe:Drosophila_2:1635682_at:355:9; Interrogation_Position=541; Antisense; ATTCTGCCCATATTGAAAATGATAA

Paste this into a BLAST search page for me
CCATATCACCACCAAGTATTATAGATCACCACCAAGTATTATAGATTAGGTAGATTAGGTCTATTCCGGCTATTCGATTAGGTCTATTCCGGCTATTCACATTAGGTCTATTCCGGCTATTCACAGGTCTATTCCGGCTATTCACATTCACTATTCCGGCTATTCACATTCACATATTCACATTCACATTTTATCTAAAATATTTATGTTCTACAATATCATTTGGATTAATCTTATCATTCTGCCCATATAATCTTATCATTCTGCCCATATTGATCTTATCATTCTGCCCATATTGAATATCATTCTGCCCATATTGAAAATGATTCTGCCCATATTGAAAATGATAA

Full Affymetrix probeset data:

Annotations for 1635682_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720