Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635683_at:

>probe:Drosophila_2:1635683_at:19:223; Interrogation_Position=1641; Antisense; AAGGTGTCATCTTCGTAGGACTTGC
>probe:Drosophila_2:1635683_at:323:485; Interrogation_Position=1655; Antisense; GTAGGACTTGCAAGGCGACCAACAT
>probe:Drosophila_2:1635683_at:523:269; Interrogation_Position=1677; Antisense; CATCAGAGAGGCATGTTGGACGCAA
>probe:Drosophila_2:1635683_at:440:465; Interrogation_Position=1691; Antisense; GTTGGACGCAATGCAAGTCTCACAT
>probe:Drosophila_2:1635683_at:448:219; Interrogation_Position=1705; Antisense; AAGTCTCACATGGAGCCTGAAGAGG
>probe:Drosophila_2:1635683_at:282:201; Interrogation_Position=1737; Antisense; AACCCAAGACGTGGTGGAGATCCAA
>probe:Drosophila_2:1635683_at:580:255; Interrogation_Position=1771; Antisense; CAAACATCTAGAAGCCGTTCCGGAA
>probe:Drosophila_2:1635683_at:35:715; Interrogation_Position=1887; Antisense; TTCTGAGATCTCTTTCTTGAAATCC
>probe:Drosophila_2:1635683_at:64:395; Interrogation_Position=1905; Antisense; GAAATCCAAGTATATCCCAAGTGAA
>probe:Drosophila_2:1635683_at:467:441; Interrogation_Position=1954; Antisense; GATGGATTTCAAAACGGCCACAATT
>probe:Drosophila_2:1635683_at:143:475; Interrogation_Position=2008; Antisense; GTTAAGTGCAATATCAAGTCGCCAA
>probe:Drosophila_2:1635683_at:421:173; Interrogation_Position=2035; Antisense; AAACCTGCAGTGAGCCAGAAGGAGT
>probe:Drosophila_2:1635683_at:543:549; Interrogation_Position=2055; Antisense; GGAGTTTGGTCGCATCTGATATGTA
>probe:Drosophila_2:1635683_at:582:483; Interrogation_Position=2077; Antisense; GTATGTCGAAAAATCCGTATTCCTA

Paste this into a BLAST search page for me
AAGGTGTCATCTTCGTAGGACTTGCGTAGGACTTGCAAGGCGACCAACATCATCAGAGAGGCATGTTGGACGCAAGTTGGACGCAATGCAAGTCTCACATAAGTCTCACATGGAGCCTGAAGAGGAACCCAAGACGTGGTGGAGATCCAACAAACATCTAGAAGCCGTTCCGGAATTCTGAGATCTCTTTCTTGAAATCCGAAATCCAAGTATATCCCAAGTGAAGATGGATTTCAAAACGGCCACAATTGTTAAGTGCAATATCAAGTCGCCAAAAACCTGCAGTGAGCCAGAAGGAGTGGAGTTTGGTCGCATCTGATATGTAGTATGTCGAAAAATCCGTATTCCTA

Full Affymetrix probeset data:

Annotations for 1635683_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime