FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635686_at:

>probe:Drosophila_2:1635686_at:452:293; Interrogation_Position=518; Antisense; CGAGAAACCGGACGCCGTGTCAGAT
>probe:Drosophila_2:1635686_at:382:291; Interrogation_Position=533; Antisense; CGTGTCAGATGCTCCCGAGGATGAG
>probe:Drosophila_2:1635686_at:373:547; Interrogation_Position=551; Antisense; GGATGAGGACCCAGGCTACCAGGCA
>probe:Drosophila_2:1635686_at:587:619; Interrogation_Position=671; Antisense; TGCTCAGCCCAGGATCTCGGAAAGT
>probe:Drosophila_2:1635686_at:564:577; Interrogation_Position=754; Antisense; GGCCCAAGATTGGTTCCAGCACCAA
>probe:Drosophila_2:1635686_at:571:125; Interrogation_Position=796; Antisense; AGCCGGGAAACAGCCTGCCAAGTGA
>probe:Drosophila_2:1635686_at:400:77; Interrogation_Position=826; Antisense; AGGTTTACCAGCACAAGCGTCGCAT
>probe:Drosophila_2:1635686_at:437:647; Interrogation_Position=850; Antisense; TCATCTTCAAGACCATCTCAACGGG
>probe:Drosophila_2:1635686_at:221:647; Interrogation_Position=867; Antisense; TCAACGGGCTCGCAATTCGTCAACT
>probe:Drosophila_2:1635686_at:524:573; Interrogation_Position=900; Antisense; GGCGACCTAATGATCAAGTTCTCAA
>probe:Drosophila_2:1635686_at:692:471; Interrogation_Position=917; Antisense; GTTCTCAATCGGATTTGCCAAGCCA
>probe:Drosophila_2:1635686_at:222:111; Interrogation_Position=963; Antisense; AGCACTGCGGGTTCACATAGTTCGT
>probe:Drosophila_2:1635686_at:692:271; Interrogation_Position=978; Antisense; CATAGTTCGTCCAGTGAGGCTTTAC
>probe:Drosophila_2:1635686_at:684:71; Interrogation_Position=994; Antisense; AGGCTTTACGTGCTCTTTCGCAAAA

Paste this into a BLAST search page for me
CGAGAAACCGGACGCCGTGTCAGATCGTGTCAGATGCTCCCGAGGATGAGGGATGAGGACCCAGGCTACCAGGCATGCTCAGCCCAGGATCTCGGAAAGTGGCCCAAGATTGGTTCCAGCACCAAAGCCGGGAAACAGCCTGCCAAGTGAAGGTTTACCAGCACAAGCGTCGCATTCATCTTCAAGACCATCTCAACGGGTCAACGGGCTCGCAATTCGTCAACTGGCGACCTAATGATCAAGTTCTCAAGTTCTCAATCGGATTTGCCAAGCCAAGCACTGCGGGTTCACATAGTTCGTCATAGTTCGTCCAGTGAGGCTTTACAGGCTTTACGTGCTCTTTCGCAAAA

Full Affymetrix probeset data:

Annotations for 1635686_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720