FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635687_at:

>probe:Drosophila_2:1635687_at:36:211; Interrogation_Position=231; Antisense; AAGCAAACACATCGACTGGCGCTGC
>probe:Drosophila_2:1635687_at:535:321; Interrogation_Position=249; Antisense; GCGCTGCTGCTGATGGATCCAGTAA
>probe:Drosophila_2:1635687_at:685:581; Interrogation_Position=307; Antisense; TGGCGCCAGACGCATAAGTGCTGAC
>probe:Drosophila_2:1635687_at:520:219; Interrogation_Position=322; Antisense; AAGTGCTGACCTTCAGTTCGAGTCG
>probe:Drosophila_2:1635687_at:462:93; Interrogation_Position=336; Antisense; AGTTCGAGTCGGTTGCTGCAGACGA
>probe:Drosophila_2:1635687_at:680:415; Interrogation_Position=366; Antisense; GAGCCGGTGGATCCAAGGCACCTAA
>probe:Drosophila_2:1635687_at:492:397; Interrogation_Position=428; Antisense; GACAAGGTGAGCGTGGCCATCAGAA
>probe:Drosophila_2:1635687_at:621:685; Interrogation_Position=536; Antisense; TATCAGCTGCCCGACATGAACTTCA
>probe:Drosophila_2:1635687_at:8:713; Interrogation_Position=557; Antisense; TTCAGCCTCAACACGTCCATGGATA
>probe:Drosophila_2:1635687_at:161:29; Interrogation_Position=579; Antisense; ATACGCTACGCAATCAGTTCCGGGA
>probe:Drosophila_2:1635687_at:678:207; Interrogation_Position=611; Antisense; AAGCAGCGTCGCGACCGAGGAAATG
>probe:Drosophila_2:1635687_at:6:561; Interrogation_Position=629; Antisense; GGAAATGCCAATTTAGCCTCCTCGG
>probe:Drosophila_2:1635687_at:9:95; Interrogation_Position=765; Antisense; AGATTTCGGAGCTGCTTTGGTAGCC
>probe:Drosophila_2:1635687_at:543:691; Interrogation_Position=780; Antisense; TTTGGTAGCCCGACACACTCAGGTT

Paste this into a BLAST search page for me
AAGCAAACACATCGACTGGCGCTGCGCGCTGCTGCTGATGGATCCAGTAATGGCGCCAGACGCATAAGTGCTGACAAGTGCTGACCTTCAGTTCGAGTCGAGTTCGAGTCGGTTGCTGCAGACGAGAGCCGGTGGATCCAAGGCACCTAAGACAAGGTGAGCGTGGCCATCAGAATATCAGCTGCCCGACATGAACTTCATTCAGCCTCAACACGTCCATGGATAATACGCTACGCAATCAGTTCCGGGAAAGCAGCGTCGCGACCGAGGAAATGGGAAATGCCAATTTAGCCTCCTCGGAGATTTCGGAGCTGCTTTGGTAGCCTTTGGTAGCCCGACACACTCAGGTT

Full Affymetrix probeset data:

Annotations for 1635687_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720