FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635688_at:

>probe:Drosophila_2:1635688_at:467:79; Interrogation_Position=119; Antisense; AGGTGGGCACCACCGGTGTCTTCAC
>probe:Drosophila_2:1635688_at:684:565; Interrogation_Position=124; Antisense; GGCACCACCGGTGTCTTCACATTGA
>probe:Drosophila_2:1635688_at:540:63; Interrogation_Position=13; Antisense; ATGGGAGGCTGTTGCTCAAAGGATT
>probe:Drosophila_2:1635688_at:568:533; Interrogation_Position=133; Antisense; GGTGTCTTCACATTGACACGCACCA
>probe:Drosophila_2:1635688_at:336:127; Interrogation_Position=157; Antisense; ACCACTAGCACCACGCGGCAGGAGA
>probe:Drosophila_2:1635688_at:470:287; Interrogation_Position=172; Antisense; CGGCAGGAGAAGACGGTGACCACCA
>probe:Drosophila_2:1635688_at:310:71; Interrogation_Position=18; Antisense; AGGCTGTTGCTCAAAGGATTTGGAT
>probe:Drosophila_2:1635688_at:564:459; Interrogation_Position=34; Antisense; GATTTGGATGACAAACGCTCGTGGA
>probe:Drosophila_2:1635688_at:122:55; Interrogation_Position=41; Antisense; ATGACAAACGCTCGTGGAGTCCCGA
>probe:Drosophila_2:1635688_at:8:159; Interrogation_Position=44; Antisense; ACAAACGCTCGTGGAGTCCCGAGGA
>probe:Drosophila_2:1635688_at:458:425; Interrogation_Position=67; Antisense; GAGACCAAGAATGGCAGCACCACAT
>probe:Drosophila_2:1635688_at:706:369; Interrogation_Position=75; Antisense; GAATGGCAGCACCACATCAACAATC
>probe:Drosophila_2:1635688_at:12:35; Interrogation_Position=90; Antisense; ATCAACAATCATTGCCCAGCCGCTG
>probe:Drosophila_2:1635688_at:121:239; Interrogation_Position=96; Antisense; AATCATTGCCCAGCCGCTGGATGAG

Paste this into a BLAST search page for me
AGGTGGGCACCACCGGTGTCTTCACGGCACCACCGGTGTCTTCACATTGAATGGGAGGCTGTTGCTCAAAGGATTGGTGTCTTCACATTGACACGCACCAACCACTAGCACCACGCGGCAGGAGACGGCAGGAGAAGACGGTGACCACCAAGGCTGTTGCTCAAAGGATTTGGATGATTTGGATGACAAACGCTCGTGGAATGACAAACGCTCGTGGAGTCCCGAACAAACGCTCGTGGAGTCCCGAGGAGAGACCAAGAATGGCAGCACCACATGAATGGCAGCACCACATCAACAATCATCAACAATCATTGCCCAGCCGCTGAATCATTGCCCAGCCGCTGGATGAG

Full Affymetrix probeset data:

Annotations for 1635688_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720