FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635689_at:

>probe:Drosophila_2:1635689_at:273:265; Interrogation_Position=110; Antisense; CAGTTTCCCGCTCCGATGATGTACA
>probe:Drosophila_2:1635689_at:703:57; Interrogation_Position=125; Antisense; ATGATGTACACGCTGATGTCCTTTC
>probe:Drosophila_2:1635689_at:629:35; Interrogation_Position=13; Antisense; ATCAGTCAACGTTCGTTCTCGACCA
>probe:Drosophila_2:1635689_at:242:59; Interrogation_Position=140; Antisense; ATGTCCTTTCCCGATCGGACGACGT
>probe:Drosophila_2:1635689_at:114:509; Interrogation_Position=156; Antisense; GGACGACGTTCGTGCCGACGGATTC
>probe:Drosophila_2:1635689_at:706:465; Interrogation_Position=286; Antisense; GTTGAGGTAAAGTACGTCGCGAATG
>probe:Drosophila_2:1635689_at:63:617; Interrogation_Position=426; Antisense; TCATCACTAGGACTCGTCACCCGGA
>probe:Drosophila_2:1635689_at:49:257; Interrogation_Position=464; Antisense; CACGGACTGTTCTCCCGAAACAAAT
>probe:Drosophila_2:1635689_at:64:167; Interrogation_Position=485; Antisense; AAATCGCCCAAGTTGTTTAGCTGTA
>probe:Drosophila_2:1635689_at:3:479; Interrogation_Position=499; Antisense; GTTTAGCTGTACTTCTTGACTTTCA
>probe:Drosophila_2:1635689_at:544:241; Interrogation_Position=528; Antisense; AATACATGCACTTGCTTATAGCAGT
>probe:Drosophila_2:1635689_at:330:217; Interrogation_Position=61; Antisense; AAGTTTGTGATGATTCTCGCCGTTG
>probe:Drosophila_2:1635689_at:554:11; Interrogation_Position=73; Antisense; ATTCTCGCCGTTGTGGGAGTGGCTA
>probe:Drosophila_2:1635689_at:460:291; Interrogation_Position=81; Antisense; CGTTGTGGGAGTGGCTACCGCCCTA

Paste this into a BLAST search page for me
CAGTTTCCCGCTCCGATGATGTACAATGATGTACACGCTGATGTCCTTTCATCAGTCAACGTTCGTTCTCGACCAATGTCCTTTCCCGATCGGACGACGTGGACGACGTTCGTGCCGACGGATTCGTTGAGGTAAAGTACGTCGCGAATGTCATCACTAGGACTCGTCACCCGGACACGGACTGTTCTCCCGAAACAAATAAATCGCCCAAGTTGTTTAGCTGTAGTTTAGCTGTACTTCTTGACTTTCAAATACATGCACTTGCTTATAGCAGTAAGTTTGTGATGATTCTCGCCGTTGATTCTCGCCGTTGTGGGAGTGGCTACGTTGTGGGAGTGGCTACCGCCCTA

Full Affymetrix probeset data:

Annotations for 1635689_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720