Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635691_at:

>probe:Drosophila_2:1635691_at:321:687; Interrogation_Position=2110; Antisense; TATACACACGCGAGCGTATAAACGA
>probe:Drosophila_2:1635691_at:633:509; Interrogation_Position=2140; Antisense; GTGCATATGCGTATGCGCAAGCTAA
>probe:Drosophila_2:1635691_at:710:481; Interrogation_Position=2198; Antisense; GTATATACTTTACACCATTTACCAT
>probe:Drosophila_2:1635691_at:75:17; Interrogation_Position=2228; Antisense; ATTTATAAGCCGATATGCCGATGAT
>probe:Drosophila_2:1635691_at:102:445; Interrogation_Position=2291; Antisense; GATGAGCTGTAAACGTTTTTGCAAA
>probe:Drosophila_2:1635691_at:517:177; Interrogation_Position=2335; Antisense; AACAAAACCGCAAAGTAACTCAGTG
>probe:Drosophila_2:1635691_at:477:193; Interrogation_Position=2351; Antisense; AACTCAGTGATTTTTACCAGCGAAG
>probe:Drosophila_2:1635691_at:199:241; Interrogation_Position=2410; Antisense; AATAAGCGCCGACGAGCAGATCAGC
>probe:Drosophila_2:1635691_at:116:277; Interrogation_Position=2447; Antisense; CTAGCGACGGGAGTATTCAGAGCAG
>probe:Drosophila_2:1635691_at:106:365; Interrogation_Position=2483; Antisense; GAATAGGGCCGCAGTTAGCACTGCC
>probe:Drosophila_2:1635691_at:144:145; Interrogation_Position=2502; Antisense; ACTGCCCCAAAATAGTGTCTGATCA
>probe:Drosophila_2:1635691_at:288:243; Interrogation_Position=2512; Antisense; AATAGTGTCTGATCATGTTGCATGC
>probe:Drosophila_2:1635691_at:233:73; Interrogation_Position=2550; Antisense; AGGCAAACATGCAACAACCACCAAG
>probe:Drosophila_2:1635691_at:643:201; Interrogation_Position=2565; Antisense; AACCACCAAGCCCAGACTGGAAGTG

Paste this into a BLAST search page for me
TATACACACGCGAGCGTATAAACGAGTGCATATGCGTATGCGCAAGCTAAGTATATACTTTACACCATTTACCATATTTATAAGCCGATATGCCGATGATGATGAGCTGTAAACGTTTTTGCAAAAACAAAACCGCAAAGTAACTCAGTGAACTCAGTGATTTTTACCAGCGAAGAATAAGCGCCGACGAGCAGATCAGCCTAGCGACGGGAGTATTCAGAGCAGGAATAGGGCCGCAGTTAGCACTGCCACTGCCCCAAAATAGTGTCTGATCAAATAGTGTCTGATCATGTTGCATGCAGGCAAACATGCAACAACCACCAAGAACCACCAAGCCCAGACTGGAAGTG

Full Affymetrix probeset data:

Annotations for 1635691_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime