Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635695_at:

>probe:Drosophila_2:1635695_at:45:661; Interrogation_Position=1694; Antisense; TAACCTCGTCCATCAAGATCTGGTC
>probe:Drosophila_2:1635695_at:624:281; Interrogation_Position=1698; Antisense; CTCGTCCATCAAGATCTGGTCGCTA
>probe:Drosophila_2:1635695_at:577:31; Interrogation_Position=1705; Antisense; ATCAAGATCTGGTCGCTAAAGCTAC
>probe:Drosophila_2:1635695_at:28:453; Interrogation_Position=1710; Antisense; GATCTGGTCGCTAAAGCTACCCATT
>probe:Drosophila_2:1635695_at:244:501; Interrogation_Position=1716; Antisense; GTCGCTAAAGCTACCCATTTCAAGT
>probe:Drosophila_2:1635695_at:348:207; Interrogation_Position=1723; Antisense; AAGCTACCCATTTCAAGTTGCCAGT
>probe:Drosophila_2:1635695_at:289:671; Interrogation_Position=1727; Antisense; TACCCATTTCAAGTTGCCAGTTCTC
>probe:Drosophila_2:1635695_at:648:17; Interrogation_Position=1732; Antisense; ATTTCAAGTTGCCAGTTCTCTGTCG
>probe:Drosophila_2:1635695_at:371:653; Interrogation_Position=1735; Antisense; TCAAGTTGCCAGTTCTCTGTCGTCT
>probe:Drosophila_2:1635695_at:69:93; Interrogation_Position=1745; Antisense; AGTTCTCTGTCGTCTCCGGAATTAA
>probe:Drosophila_2:1635695_at:440:641; Interrogation_Position=1748; Antisense; TCTCTGTCGTCTCCGGAATTAATTC
>probe:Drosophila_2:1635695_at:13:287; Interrogation_Position=1751; Antisense; CTGTCGTCTCCGGAATTAATTCAAA
>probe:Drosophila_2:1635695_at:180:655; Interrogation_Position=1767; Antisense; TAATTCAAATAAGCCGCTGTACTCC
>probe:Drosophila_2:1635695_at:244:315; Interrogation_Position=2049; Antisense; GCCATCGCGCGACGAGATCAAGATG

Paste this into a BLAST search page for me
TAACCTCGTCCATCAAGATCTGGTCCTCGTCCATCAAGATCTGGTCGCTAATCAAGATCTGGTCGCTAAAGCTACGATCTGGTCGCTAAAGCTACCCATTGTCGCTAAAGCTACCCATTTCAAGTAAGCTACCCATTTCAAGTTGCCAGTTACCCATTTCAAGTTGCCAGTTCTCATTTCAAGTTGCCAGTTCTCTGTCGTCAAGTTGCCAGTTCTCTGTCGTCTAGTTCTCTGTCGTCTCCGGAATTAATCTCTGTCGTCTCCGGAATTAATTCCTGTCGTCTCCGGAATTAATTCAAATAATTCAAATAAGCCGCTGTACTCCGCCATCGCGCGACGAGATCAAGATG

Full Affymetrix probeset data:

Annotations for 1635695_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime