FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635700_at:

>probe:Drosophila_2:1635700_at:297:523; Interrogation_Position=3448; Antisense; GTGGCCACTGGCCTGGAGACCAAAA
>probe:Drosophila_2:1635700_at:624:265; Interrogation_Position=3476; Antisense; CAGAGGGTGGCTCCAACTTTAGCGT
>probe:Drosophila_2:1635700_at:136:585; Interrogation_Position=3524; Antisense; TGGCACGAGCTATTCTGCGCGACAA
>probe:Drosophila_2:1635700_at:143:339; Interrogation_Position=3601; Antisense; GCTCTGATCCAAGCCACAATTCGAA
>probe:Drosophila_2:1635700_at:286:159; Interrogation_Position=3626; Antisense; ACAAGTTCAGGGAGTGCACCGTCCT
>probe:Drosophila_2:1635700_at:11:709; Interrogation_Position=3650; Antisense; TTACCGTGGCCCATAGATTGCACAC
>probe:Drosophila_2:1635700_at:280:647; Interrogation_Position=3677; Antisense; TCATGGACTCGGACCGTGTACTGGT
>probe:Drosophila_2:1635700_at:476:417; Interrogation_Position=3716; Antisense; GAGTTGTGGAATTCGGGACGCCCTA
>probe:Drosophila_2:1635700_at:17:557; Interrogation_Position=3731; Antisense; GGACGCCCTATGAGCTTTTAACTGC
>probe:Drosophila_2:1635700_at:62:145; Interrogation_Position=3751; Antisense; ACTGCCGATGATACTAATGCCTTCC
>probe:Drosophila_2:1635700_at:32:657; Interrogation_Position=3765; Antisense; TAATGCCTTCCAAGACCTGGTCAAG
>probe:Drosophila_2:1635700_at:662:529; Interrogation_Position=3795; Antisense; GGGTCAGGCAACATACGACACTCTC
>probe:Drosophila_2:1635700_at:355:399; Interrogation_Position=3811; Antisense; GACACTCTCCTGAAGATTTCTCAAC
>probe:Drosophila_2:1635700_at:573:387; Interrogation_Position=3912; Antisense; GAAAAACCGAGCCTTATGCTTCCCT

Paste this into a BLAST search page for me
GTGGCCACTGGCCTGGAGACCAAAACAGAGGGTGGCTCCAACTTTAGCGTTGGCACGAGCTATTCTGCGCGACAAGCTCTGATCCAAGCCACAATTCGAAACAAGTTCAGGGAGTGCACCGTCCTTTACCGTGGCCCATAGATTGCACACTCATGGACTCGGACCGTGTACTGGTGAGTTGTGGAATTCGGGACGCCCTAGGACGCCCTATGAGCTTTTAACTGCACTGCCGATGATACTAATGCCTTCCTAATGCCTTCCAAGACCTGGTCAAGGGGTCAGGCAACATACGACACTCTCGACACTCTCCTGAAGATTTCTCAACGAAAAACCGAGCCTTATGCTTCCCT

Full Affymetrix probeset data:

Annotations for 1635700_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720