FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635701_at:

>probe:Drosophila_2:1635701_at:65:591; Interrogation_Position=204; Antisense; TGGTTTCACCATTTGGGAGTCGCGT
>probe:Drosophila_2:1635701_at:30:315; Interrogation_Position=229; Antisense; GCCATTCTCGTTTACCTGGTGGAAA
>probe:Drosophila_2:1635701_at:316:223; Interrogation_Position=262; Antisense; AAGGATGACGCGCTGTACCCCAAGG
>probe:Drosophila_2:1635701_at:232:487; Interrogation_Position=276; Antisense; GTACCCCAAGGATATTCAGAAGCAG
>probe:Drosophila_2:1635701_at:531:533; Interrogation_Position=303; Antisense; GGTGATCAATCAACGCCTTTACTTC
>probe:Drosophila_2:1635701_at:511:291; Interrogation_Position=318; Antisense; CCTTTACTTCGACATGGCGTTGATG
>probe:Drosophila_2:1635701_at:38:69; Interrogation_Position=331; Antisense; ATGGCGTTGATGTATCCCACCCTGG
>probe:Drosophila_2:1635701_at:324:705; Interrogation_Position=377; Antisense; TTACCACCGGTCAGTTTGGCAGCGA
>probe:Drosophila_2:1635701_at:547:549; Interrogation_Position=423; Antisense; GGAGACTTTCGATTTCCTAAACACA
>probe:Drosophila_2:1635701_at:298:527; Interrogation_Position=476; Antisense; GGGACCAGTATACCGTCGCCGACAT
>probe:Drosophila_2:1635701_at:450:299; Interrogation_Position=510; Antisense; CGCCAATGTCTCCAATTTCGATGTT
>probe:Drosophila_2:1635701_at:150:369; Interrogation_Position=561; Antisense; GAATGTGGCCCGATGGTACGACCAT
>probe:Drosophila_2:1635701_at:37:601; Interrogation_Position=585; Antisense; TGTCAAGAAGATTACCCCTGGATGG
>probe:Drosophila_2:1635701_at:74:197; Interrogation_Position=616; Antisense; AACTGGGCAGGAGCTCTGGATGTAA

Paste this into a BLAST search page for me
TGGTTTCACCATTTGGGAGTCGCGTGCCATTCTCGTTTACCTGGTGGAAAAAGGATGACGCGCTGTACCCCAAGGGTACCCCAAGGATATTCAGAAGCAGGGTGATCAATCAACGCCTTTACTTCCCTTTACTTCGACATGGCGTTGATGATGGCGTTGATGTATCCCACCCTGGTTACCACCGGTCAGTTTGGCAGCGAGGAGACTTTCGATTTCCTAAACACAGGGACCAGTATACCGTCGCCGACATCGCCAATGTCTCCAATTTCGATGTTGAATGTGGCCCGATGGTACGACCATTGTCAAGAAGATTACCCCTGGATGGAACTGGGCAGGAGCTCTGGATGTAA

Full Affymetrix probeset data:

Annotations for 1635701_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720