Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635704_at:

>probe:Drosophila_2:1635704_at:123:155; Interrogation_Position=1085; Antisense; ACAGATGCCTTACGGCGAGCGCGAA
>probe:Drosophila_2:1635704_at:458:109; Interrogation_Position=1135; Antisense; AGAATAAGGATTACGACCGCCACCG
>probe:Drosophila_2:1635704_at:406:25; Interrogation_Position=1186; Antisense; ATAGACAAAGCTCGCGTAGCCGCAG
>probe:Drosophila_2:1635704_at:12:417; Interrogation_Position=1292; Antisense; GAGCCGGCACAACGAACACTATGAA
>probe:Drosophila_2:1635704_at:591:509; Interrogation_Position=1321; Antisense; GTGAGCGACGTCATCGGTGAAGACC
>probe:Drosophila_2:1635704_at:179:631; Interrogation_Position=1369; Antisense; TCCTCCTCCTTAAGTTGTTCTGTTA
>probe:Drosophila_2:1635704_at:481:277; Interrogation_Position=1402; Antisense; CTTTGTTTCACCATAGTACTACTAC
>probe:Drosophila_2:1635704_at:417:193; Interrogation_Position=1448; Antisense; AACTCTATCTACACTTTGGAAGCCA
>probe:Drosophila_2:1635704_at:125:563; Interrogation_Position=1465; Antisense; GGAAGCCACGAACGTCAGTTGCGCT
>probe:Drosophila_2:1635704_at:136:95; Interrogation_Position=1481; Antisense; AGTTGCGCTTCTTACTCAGGTTAAA
>probe:Drosophila_2:1635704_at:184:669; Interrogation_Position=1493; Antisense; TACTCAGGTTAAACACTCTCCGAAA
>probe:Drosophila_2:1635704_at:10:37; Interrogation_Position=1546; Antisense; ATCTAGACACAATCACATGCGGACA
>probe:Drosophila_2:1635704_at:96:623; Interrogation_Position=1563; Antisense; TGCGGACACAGCAGCAAGGCTATAT
>probe:Drosophila_2:1635704_at:337:729; Interrogation_Position=1596; Antisense; TTGTGACTACACTTACGCTGATAAA

Paste this into a BLAST search page for me
ACAGATGCCTTACGGCGAGCGCGAAAGAATAAGGATTACGACCGCCACCGATAGACAAAGCTCGCGTAGCCGCAGGAGCCGGCACAACGAACACTATGAAGTGAGCGACGTCATCGGTGAAGACCTCCTCCTCCTTAAGTTGTTCTGTTACTTTGTTTCACCATAGTACTACTACAACTCTATCTACACTTTGGAAGCCAGGAAGCCACGAACGTCAGTTGCGCTAGTTGCGCTTCTTACTCAGGTTAAATACTCAGGTTAAACACTCTCCGAAAATCTAGACACAATCACATGCGGACATGCGGACACAGCAGCAAGGCTATATTTGTGACTACACTTACGCTGATAAA

Full Affymetrix probeset data:

Annotations for 1635704_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime