Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635705_at:

>probe:Drosophila_2:1635705_at:428:135; Interrogation_Position=2897; Antisense; ACGAATTTTCACATAGCAGCTTAGC
>probe:Drosophila_2:1635705_at:708:701; Interrogation_Position=3007; Antisense; TTATATTAGTTGCATGGCGCCGGGC
>probe:Drosophila_2:1635705_at:597:451; Interrogation_Position=3045; Antisense; GATCATCCCGGATTTAGTTTTCAGT
>probe:Drosophila_2:1635705_at:583:419; Interrogation_Position=3073; Antisense; GAGCATGCAGAGCTTGTTGCCTACT
>probe:Drosophila_2:1635705_at:633:469; Interrogation_Position=3088; Antisense; GTTGCCTACTTTTGGGCGATCACCA
>probe:Drosophila_2:1635705_at:90:525; Interrogation_Position=3101; Antisense; GGGCGATCACCAAAGCAAATTACTC
>probe:Drosophila_2:1635705_at:251:667; Interrogation_Position=3121; Antisense; TACTCATACGCATGGGTTACCCGTT
>probe:Drosophila_2:1635705_at:376:471; Interrogation_Position=3143; Antisense; GTTCGCTCCGAAATACACATAAAGT
>probe:Drosophila_2:1635705_at:556:439; Interrogation_Position=3237; Antisense; GAGGCGTTTCAAGGCTACAGGACAT
>probe:Drosophila_2:1635705_at:698:83; Interrogation_Position=3270; Antisense; AGTGGGAGCTGCTTCGTTTAGCCGC
>probe:Drosophila_2:1635705_at:45:479; Interrogation_Position=3285; Antisense; GTTTAGCCGCAGTTGATTATGACTT
>probe:Drosophila_2:1635705_at:453:677; Interrogation_Position=3343; Antisense; TAGATTATCCGTTGTCTTATGGCTT
>probe:Drosophila_2:1635705_at:631:497; Interrogation_Position=3356; Antisense; GTCTTATGGCTTTGAAACGCACCGT
>probe:Drosophila_2:1635705_at:614:197; Interrogation_Position=3371; Antisense; AACGCACCGTGTGGATTACCCAATA

Paste this into a BLAST search page for me
ACGAATTTTCACATAGCAGCTTAGCTTATATTAGTTGCATGGCGCCGGGCGATCATCCCGGATTTAGTTTTCAGTGAGCATGCAGAGCTTGTTGCCTACTGTTGCCTACTTTTGGGCGATCACCAGGGCGATCACCAAAGCAAATTACTCTACTCATACGCATGGGTTACCCGTTGTTCGCTCCGAAATACACATAAAGTGAGGCGTTTCAAGGCTACAGGACATAGTGGGAGCTGCTTCGTTTAGCCGCGTTTAGCCGCAGTTGATTATGACTTTAGATTATCCGTTGTCTTATGGCTTGTCTTATGGCTTTGAAACGCACCGTAACGCACCGTGTGGATTACCCAATA

Full Affymetrix probeset data:

Annotations for 1635705_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime