Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635706_at:

>probe:Drosophila_2:1635706_at:45:101; Interrogation_Position=145; Antisense; AGAGACGCATCTTCAAGCTGGCAGC
>probe:Drosophila_2:1635706_at:335:687; Interrogation_Position=174; Antisense; TATAGAAGCCGCACTCGCAATGTCT
>probe:Drosophila_2:1635706_at:508:549; Interrogation_Position=214; Antisense; GGAGTGTCCATAGGGCACTGGCCTA
>probe:Drosophila_2:1635706_at:680:399; Interrogation_Position=270; Antisense; GACATGGCGCAACTGTGGAGCACAC
>probe:Drosophila_2:1635706_at:6:357; Interrogation_Position=333; Antisense; GAAACCTTCAAAGAGGGCCTCGCGC
>probe:Drosophila_2:1635706_at:557:297; Interrogation_Position=357; Antisense; CGCTCCGATATTCTGCTCAACAAAA
>probe:Drosophila_2:1635706_at:355:413; Interrogation_Position=393; Antisense; GACCTCGCCATTTGGGAGCCGCGAT
>probe:Drosophila_2:1635706_at:617:317; Interrogation_Position=410; Antisense; GCCGCGATCTTTTGAAGCTCTAGTA
>probe:Drosophila_2:1635706_at:647:563; Interrogation_Position=465; Antisense; GGAATGCCAGACATCAAACGGAGAT
>probe:Drosophila_2:1635706_at:483:425; Interrogation_Position=485; Antisense; GAGATCGGCATTTAACCAGGTCTAT
>probe:Drosophila_2:1635706_at:177:497; Interrogation_Position=504; Antisense; GTCTATGGACTGAGCAACCTGAAGT
>probe:Drosophila_2:1635706_at:626:177; Interrogation_Position=52; Antisense; AAACTCGACCGATATTCTGTTAATA
>probe:Drosophila_2:1635706_at:287:23; Interrogation_Position=74; Antisense; ATATCAAGCCATGGTCTTCCTGAAC
>probe:Drosophila_2:1635706_at:520:423; Interrogation_Position=94; Antisense; TGAACCTTCCCTTGCTGGTACGGTC

Paste this into a BLAST search page for me
AGAGACGCATCTTCAAGCTGGCAGCTATAGAAGCCGCACTCGCAATGTCTGGAGTGTCCATAGGGCACTGGCCTAGACATGGCGCAACTGTGGAGCACACGAAACCTTCAAAGAGGGCCTCGCGCCGCTCCGATATTCTGCTCAACAAAAGACCTCGCCATTTGGGAGCCGCGATGCCGCGATCTTTTGAAGCTCTAGTAGGAATGCCAGACATCAAACGGAGATGAGATCGGCATTTAACCAGGTCTATGTCTATGGACTGAGCAACCTGAAGTAAACTCGACCGATATTCTGTTAATAATATCAAGCCATGGTCTTCCTGAACTGAACCTTCCCTTGCTGGTACGGTC

Full Affymetrix probeset data:

Annotations for 1635706_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime