FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635708_at:

>probe:Drosophila_2:1635708_at:248:103; Interrogation_Position=2934; Antisense; AGAGCTGGCGCAGTTTGTGCTTCAG
>probe:Drosophila_2:1635708_at:417:673; Interrogation_Position=2967; Antisense; TACCCAGTTTTTGGTGGTCCAGCGG
>probe:Drosophila_2:1635708_at:516:347; Interrogation_Position=3006; Antisense; GCATGCGGGCTTGGTGATCACTATA
>probe:Drosophila_2:1635708_at:46:107; Interrogation_Position=3069; Antisense; AGAACAGCTGCTAACCGTTTTGCGC
>probe:Drosophila_2:1635708_at:50:47; Interrogation_Position=3103; Antisense; ATCCCGCTGCTGGAACACGTAATGT
>probe:Drosophila_2:1635708_at:655:469; Interrogation_Position=3126; Antisense; GTTCGTGGACGAAGTGGACCTCAGT
>probe:Drosophila_2:1635708_at:579:553; Interrogation_Position=3141; Antisense; GGACCTCAGTCGCAACCAAGTGTTT
>probe:Drosophila_2:1635708_at:453:509; Interrogation_Position=3178; Antisense; GTGCTTATATCGCACGATGCCTACA
>probe:Drosophila_2:1635708_at:531:159; Interrogation_Position=3200; Antisense; ACAAGCGATCACAGGCGGTCAGGGA
>probe:Drosophila_2:1635708_at:15:459; Interrogation_Position=3223; Antisense; GATATGTGCTCCAATCACTTGCGAT
>probe:Drosophila_2:1635708_at:299:259; Interrogation_Position=3271; Antisense; CACTGCACTTACTTTTACTTCCAGA
>probe:Drosophila_2:1635708_at:620:621; Interrogation_Position=3296; Antisense; TGCTGATCAACCTGGCAGAGCTGGC
>probe:Drosophila_2:1635708_at:222:335; Interrogation_Position=3334; Antisense; GCTCCCATCCTATCCTTTATAAGGG
>probe:Drosophila_2:1635708_at:468:85; Interrogation_Position=3416; Antisense; AGTGCTTGCAGCGACTCCAAAAGGT

Paste this into a BLAST search page for me
AGAGCTGGCGCAGTTTGTGCTTCAGTACCCAGTTTTTGGTGGTCCAGCGGGCATGCGGGCTTGGTGATCACTATAAGAACAGCTGCTAACCGTTTTGCGCATCCCGCTGCTGGAACACGTAATGTGTTCGTGGACGAAGTGGACCTCAGTGGACCTCAGTCGCAACCAAGTGTTTGTGCTTATATCGCACGATGCCTACAACAAGCGATCACAGGCGGTCAGGGAGATATGTGCTCCAATCACTTGCGATCACTGCACTTACTTTTACTTCCAGATGCTGATCAACCTGGCAGAGCTGGCGCTCCCATCCTATCCTTTATAAGGGAGTGCTTGCAGCGACTCCAAAAGGT

Full Affymetrix probeset data:

Annotations for 1635708_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720