FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635709_at:

>probe:Drosophila_2:1635709_at:50:129; Interrogation_Position=1173; Antisense; ACCAACCACACCATATTCATTCATA
>probe:Drosophila_2:1635709_at:593:335; Interrogation_Position=1257; Antisense; GCTCCCGAGGATTGTTTTACTTCTA
>probe:Drosophila_2:1635709_at:588:291; Interrogation_Position=1298; Antisense; GCGTTATTTACGGTCTGGGATTCCA
>probe:Drosophila_2:1635709_at:306:699; Interrogation_Position=1327; Antisense; TTATTAACTCCCATTTCATTTCGCC
>probe:Drosophila_2:1635709_at:163:333; Interrogation_Position=1356; Antisense; GCTTCCGTTGCGCAGGTTTTCTAAA
>probe:Drosophila_2:1635709_at:247:637; Interrogation_Position=1400; Antisense; TTTAGTTTAGACGACCTTTGAGCCA
>probe:Drosophila_2:1635709_at:282:409; Interrogation_Position=1412; Antisense; GACCTTTGAGCCAAGTCGGTTGACT
>probe:Drosophila_2:1635709_at:107:539; Interrogation_Position=1429; Antisense; GGTTGACTACGACCCAAATCTGTAA
>probe:Drosophila_2:1635709_at:639:285; Interrogation_Position=1448; Antisense; CTGTAAATTATGAGCGTCGATCCGT
>probe:Drosophila_2:1635709_at:535:121; Interrogation_Position=1460; Antisense; AGCGTCGATCCGTGTGTGTGTGTAT
>probe:Drosophila_2:1635709_at:690:5; Interrogation_Position=1495; Antisense; ATTGTAGATGGATCGCTGCATAGCG
>probe:Drosophila_2:1635709_at:431:47; Interrogation_Position=1527; Antisense; ATCCGGCGGAGTGCTTGATACAAGC
>probe:Drosophila_2:1635709_at:330:177; Interrogation_Position=1715; Antisense; AAACTGTGTTCGATGCACTACCCAA
>probe:Drosophila_2:1635709_at:619:615; Interrogation_Position=1728; Antisense; TGCACTACCCAAGCCCGAAAGATAG

Paste this into a BLAST search page for me
ACCAACCACACCATATTCATTCATAGCTCCCGAGGATTGTTTTACTTCTAGCGTTATTTACGGTCTGGGATTCCATTATTAACTCCCATTTCATTTCGCCGCTTCCGTTGCGCAGGTTTTCTAAATTTAGTTTAGACGACCTTTGAGCCAGACCTTTGAGCCAAGTCGGTTGACTGGTTGACTACGACCCAAATCTGTAACTGTAAATTATGAGCGTCGATCCGTAGCGTCGATCCGTGTGTGTGTGTATATTGTAGATGGATCGCTGCATAGCGATCCGGCGGAGTGCTTGATACAAGCAAACTGTGTTCGATGCACTACCCAATGCACTACCCAAGCCCGAAAGATAG

Full Affymetrix probeset data:

Annotations for 1635709_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720