FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635710_at:

>probe:Drosophila_2:1635710_at:417:279; Interrogation_Position=1026; Antisense; CTACACACTTCTGGGTAAGCGCTAA
>probe:Drosophila_2:1635710_at:267:363; Interrogation_Position=593; Antisense; GCAATTGCGGCACGCTCAAAAGCAA
>probe:Drosophila_2:1635710_at:532:209; Interrogation_Position=612; Antisense; AAGCAATGCGAAACTCTTGCCGCTC
>probe:Drosophila_2:1635710_at:652:177; Interrogation_Position=622; Antisense; AAACTCTTGCCGCTCCAATTGATGG
>probe:Drosophila_2:1635710_at:607:71; Interrogation_Position=692; Antisense; AGGCGGCCTCGATTCAGGCCCAAGC
>probe:Drosophila_2:1635710_at:727:69; Interrogation_Position=707; Antisense; AGGCCCAAGCGCAGGTGCAGCACCA
>probe:Drosophila_2:1635710_at:165:83; Interrogation_Position=824; Antisense; AGGGCTGGTGCTCCTGTTTCAGTTC
>probe:Drosophila_2:1635710_at:601:601; Interrogation_Position=838; Antisense; TGTTTCAGTTCGACGCCAGGAGGTG
>probe:Drosophila_2:1635710_at:374:717; Interrogation_Position=893; Antisense; TTGCTGCTGGTGAGACCGGAAAGAC
>probe:Drosophila_2:1635710_at:486:201; Interrogation_Position=903; Antisense; TGAGACCGGAAAGACGCCACCCGGA
>probe:Drosophila_2:1635710_at:538:213; Interrogation_Position=958; Antisense; AAGGCCACCTCACAAACGGTGTGGT
>probe:Drosophila_2:1635710_at:499:177; Interrogation_Position=971; Antisense; AAACGGTGTGGTCCGCCCTGCTGAC
>probe:Drosophila_2:1635710_at:588:621; Interrogation_Position=989; Antisense; TGCTGACAAACCTGGGCATCTGCAT
>probe:Drosophila_2:1635710_at:70:175; Interrogation_Position=996; Antisense; AAACCTGGGCATCTGCATGCTGCTT

Paste this into a BLAST search page for me
CTACACACTTCTGGGTAAGCGCTAAGCAATTGCGGCACGCTCAAAAGCAAAAGCAATGCGAAACTCTTGCCGCTCAAACTCTTGCCGCTCCAATTGATGGAGGCGGCCTCGATTCAGGCCCAAGCAGGCCCAAGCGCAGGTGCAGCACCAAGGGCTGGTGCTCCTGTTTCAGTTCTGTTTCAGTTCGACGCCAGGAGGTGTTGCTGCTGGTGAGACCGGAAAGACTGAGACCGGAAAGACGCCACCCGGAAAGGCCACCTCACAAACGGTGTGGTAAACGGTGTGGTCCGCCCTGCTGACTGCTGACAAACCTGGGCATCTGCATAAACCTGGGCATCTGCATGCTGCTT

Full Affymetrix probeset data:

Annotations for 1635710_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720