Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635712_at:

>probe:Drosophila_2:1635712_at:537:321; Interrogation_Position=3178; Antisense; GCGCGATGTGGCACCAACAACATTT
>probe:Drosophila_2:1635712_at:17:473; Interrogation_Position=3226; Antisense; GTTCAACAGCACCATGGTTACCTTC
>probe:Drosophila_2:1635712_at:601:695; Interrogation_Position=3243; Antisense; TTACCTTCCTCAAACGGCCACAGTT
>probe:Drosophila_2:1635712_at:505:147; Interrogation_Position=3294; Antisense; ACTAGTTATTCCTAGGTGCCATAAG
>probe:Drosophila_2:1635712_at:377:707; Interrogation_Position=3319; Antisense; TTAGCTCATATATAAGCCCTCCCAG
>probe:Drosophila_2:1635712_at:92:659; Interrogation_Position=3331; Antisense; TAAGCCCTCCCAGTAGCAGAGAATG
>probe:Drosophila_2:1635712_at:323:431; Interrogation_Position=3364; Antisense; GAGTCTTCTCGAGAAGCATCACCTC
>probe:Drosophila_2:1635712_at:109:189; Interrogation_Position=3391; Antisense; AACACCACATTTAAACACACTCTCA
>probe:Drosophila_2:1635712_at:327:489; Interrogation_Position=3439; Antisense; GTACATTACTTTGTCCCAAGCTGTG
>probe:Drosophila_2:1635712_at:517:613; Interrogation_Position=3462; Antisense; TGAACGATGCAATCAAGCGACGCTG
>probe:Drosophila_2:1635712_at:405:123; Interrogation_Position=3477; Antisense; AGCGACGCTGCTTACAAATTGACAG
>probe:Drosophila_2:1635712_at:369:329; Interrogation_Position=3644; Antisense; GCGTGTAAGTAGTTCTGCCTGGTCT
>probe:Drosophila_2:1635712_at:405:537; Interrogation_Position=3664; Antisense; GGTCTTGCTGGTCCTACGAAGGCAA
>probe:Drosophila_2:1635712_at:18:165; Interrogation_Position=3743; Antisense; AAATCATACGCAAAACACCCATCTT

Paste this into a BLAST search page for me
GCGCGATGTGGCACCAACAACATTTGTTCAACAGCACCATGGTTACCTTCTTACCTTCCTCAAACGGCCACAGTTACTAGTTATTCCTAGGTGCCATAAGTTAGCTCATATATAAGCCCTCCCAGTAAGCCCTCCCAGTAGCAGAGAATGGAGTCTTCTCGAGAAGCATCACCTCAACACCACATTTAAACACACTCTCAGTACATTACTTTGTCCCAAGCTGTGTGAACGATGCAATCAAGCGACGCTGAGCGACGCTGCTTACAAATTGACAGGCGTGTAAGTAGTTCTGCCTGGTCTGGTCTTGCTGGTCCTACGAAGGCAAAAATCATACGCAAAACACCCATCTT

Full Affymetrix probeset data:

Annotations for 1635712_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime