Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635713_at:

>probe:Drosophila_2:1635713_at:6:389; Interrogation_Position=15610; Antisense; GAAAACCTTTTGCTCATTCTCAGCG
>probe:Drosophila_2:1635713_at:535:619; Interrogation_Position=15620; Antisense; TGCTCATTCTCAGCGATGGACGTAA
>probe:Drosophila_2:1635713_at:719:657; Interrogation_Position=15684; Antisense; TAAGTTGGCGCGTCTGCAGCGCATC
>probe:Drosophila_2:1635713_at:146:123; Interrogation_Position=15701; Antisense; AGCGCATCTTCCTGGTATACATCAT
>probe:Drosophila_2:1635713_at:70:385; Interrogation_Position=15747; Antisense; GAACTCAATTCTGGACATACAACAT
>probe:Drosophila_2:1635713_at:42:271; Interrogation_Position=15762; Antisense; CATACAACATGTGGCGGTGAACGCA
>probe:Drosophila_2:1635713_at:66:651; Interrogation_Position=15804; Antisense; TAATTCCTACCTGGACAGTTTTCCT
>probe:Drosophila_2:1635713_at:2:263; Interrogation_Position=15819; Antisense; CAGTTTTCCTTTTCCGTACTATGTG
>probe:Drosophila_2:1635713_at:599:453; Interrogation_Position=15843; Antisense; GATAGTCCGGGACCTTAACCAGCTG
>probe:Drosophila_2:1635713_at:75:287; Interrogation_Position=15871; Antisense; CTGGTGCTCAGCGAAGCCATGAGAC
>probe:Drosophila_2:1635713_at:303:539; Interrogation_Position=15909; Antisense; GGTTAACAGCGAGTAATCATTGCAT
>probe:Drosophila_2:1635713_at:662:123; Interrogation_Position=15996; Antisense; AGCCCACTTAGTTATATTTCACATG
>probe:Drosophila_2:1635713_at:50:229; Interrogation_Position=16046; Antisense; AATGTGACCGAGTGTACGATTGTTC
>probe:Drosophila_2:1635713_at:311:489; Interrogation_Position=16059; Antisense; GTACGATTGTTCACTAATGCTTTTA

Paste this into a BLAST search page for me
GAAAACCTTTTGCTCATTCTCAGCGTGCTCATTCTCAGCGATGGACGTAATAAGTTGGCGCGTCTGCAGCGCATCAGCGCATCTTCCTGGTATACATCATGAACTCAATTCTGGACATACAACATCATACAACATGTGGCGGTGAACGCATAATTCCTACCTGGACAGTTTTCCTCAGTTTTCCTTTTCCGTACTATGTGGATAGTCCGGGACCTTAACCAGCTGCTGGTGCTCAGCGAAGCCATGAGACGGTTAACAGCGAGTAATCATTGCATAGCCCACTTAGTTATATTTCACATGAATGTGACCGAGTGTACGATTGTTCGTACGATTGTTCACTAATGCTTTTA

Full Affymetrix probeset data:

Annotations for 1635713_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime