FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635715_at:

>probe:Drosophila_2:1635715_at:614:223; Interrogation_Position=119; Antisense; AAGGTATCACGAAGCCTGCTATCCG
>probe:Drosophila_2:1635715_at:107:291; Interrogation_Position=162; Antisense; CGGTGTGAAGCGCATATCTGGACTC
>probe:Drosophila_2:1635715_at:529:345; Interrogation_Position=173; Antisense; GCATATCTGGACTCATATACGAGGA
>probe:Drosophila_2:1635715_at:84:133; Interrogation_Position=199; Antisense; ACGCGTGGCGTTCTGAAGGTTTTCT
>probe:Drosophila_2:1635715_at:217:493; Interrogation_Position=232; Antisense; GTAATTCGTGATGCCGTGACCTACA
>probe:Drosophila_2:1635715_at:233:611; Interrogation_Position=248; Antisense; TGACCTACACGGAACACGCCAAGAG
>probe:Drosophila_2:1635715_at:10:439; Interrogation_Position=270; Antisense; GAGGAAGACAGTTACAGCCATGGAT
>probe:Drosophila_2:1635715_at:262:315; Interrogation_Position=286; Antisense; GCCATGGATGTTGTGTACGCTCTGA
>probe:Drosophila_2:1635715_at:383:671; Interrogation_Position=301; Antisense; TACGCTCTGAAGAGGCAAGGCCGCA
>probe:Drosophila_2:1635715_at:677:223; Interrogation_Position=317; Antisense; AAGGCCGCACCCTCTACGGATTTGG
>probe:Drosophila_2:1635715_at:362:221; Interrogation_Position=350; Antisense; AAGTGTACATCCTGTGTACCCCTAT
>probe:Drosophila_2:1635715_at:499:487; Interrogation_Position=365; Antisense; GTACCCCTATTAAGCAATCGGTCCT
>probe:Drosophila_2:1635715_at:465:297; Interrogation_Position=81; Antisense; CGCCAAGCGTCATCGCAAAGTGCTG
>probe:Drosophila_2:1635715_at:350:255; Interrogation_Position=96; Antisense; CAAAGTGCTGCGTGATAACATCCAA

Paste this into a BLAST search page for me
AAGGTATCACGAAGCCTGCTATCCGCGGTGTGAAGCGCATATCTGGACTCGCATATCTGGACTCATATACGAGGAACGCGTGGCGTTCTGAAGGTTTTCTGTAATTCGTGATGCCGTGACCTACATGACCTACACGGAACACGCCAAGAGGAGGAAGACAGTTACAGCCATGGATGCCATGGATGTTGTGTACGCTCTGATACGCTCTGAAGAGGCAAGGCCGCAAAGGCCGCACCCTCTACGGATTTGGAAGTGTACATCCTGTGTACCCCTATGTACCCCTATTAAGCAATCGGTCCTCGCCAAGCGTCATCGCAAAGTGCTGCAAAGTGCTGCGTGATAACATCCAA

Full Affymetrix probeset data:

Annotations for 1635715_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720