FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635716_at:

>probe:Drosophila_2:1635716_at:330:281; Interrogation_Position=152; Antisense; CTCAGGCTCCCAACATGAACAAGGA
>probe:Drosophila_2:1635716_at:10:333; Interrogation_Position=177; Antisense; GCTGGGCATCCCATCAAACGCTGGA
>probe:Drosophila_2:1635716_at:48:83; Interrogation_Position=308; Antisense; AGGGCATGTTCAGCATCAGCCAGCT
>probe:Drosophila_2:1635716_at:483:261; Interrogation_Position=328; Antisense; CAGCTGAACATCGAGCTCACCGAGG
>probe:Drosophila_2:1635716_at:674:111; Interrogation_Position=364; Antisense; AGCAACAGTCGCATGGAGATCACCT
>probe:Drosophila_2:1635716_at:539:311; Interrogation_Position=416; Antisense; GCCAGGGTGAGCAGTACGCCGACTA
>probe:Drosophila_2:1635716_at:704:483; Interrogation_Position=429; Antisense; GTACGCCGACTACAAGACTTACTCA
>probe:Drosophila_2:1635716_at:389:519; Interrogation_Position=466; Antisense; GTGGAGCGACAATTGGCCTCCTCTA
>probe:Drosophila_2:1635716_at:254:407; Interrogation_Position=495; Antisense; GACGGCTTCGCCGAGCATCGGAATG
>probe:Drosophila_2:1635716_at:211:619; Interrogation_Position=52; Antisense; TGCGTGCCCGGCATGAACAGCAACC
>probe:Drosophila_2:1635716_at:481:355; Interrogation_Position=574; Antisense; GCACATGGTACGGTAGTGACGCACT
>probe:Drosophila_2:1635716_at:581:85; Interrogation_Position=588; Antisense; AGTGACGCACTTGTGGTCGCTAGCC
>probe:Drosophila_2:1635716_at:632:201; Interrogation_Position=73; Antisense; AACCGCAAGTATCGGCGCCACATAA
>probe:Drosophila_2:1635716_at:455:151; Interrogation_Position=92; Antisense; ACATAAACGAGAACGCCCTGGGCAT

Paste this into a BLAST search page for me
CTCAGGCTCCCAACATGAACAAGGAGCTGGGCATCCCATCAAACGCTGGAAGGGCATGTTCAGCATCAGCCAGCTCAGCTGAACATCGAGCTCACCGAGGAGCAACAGTCGCATGGAGATCACCTGCCAGGGTGAGCAGTACGCCGACTAGTACGCCGACTACAAGACTTACTCAGTGGAGCGACAATTGGCCTCCTCTAGACGGCTTCGCCGAGCATCGGAATGTGCGTGCCCGGCATGAACAGCAACCGCACATGGTACGGTAGTGACGCACTAGTGACGCACTTGTGGTCGCTAGCCAACCGCAAGTATCGGCGCCACATAAACATAAACGAGAACGCCCTGGGCAT

Full Affymetrix probeset data:

Annotations for 1635716_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720