Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635718_at:

>probe:Drosophila_2:1635718_at:361:601; Interrogation_Position=2345; Antisense; TGTACGCGATATATCCAAGCTGGAT
>probe:Drosophila_2:1635718_at:465:531; Interrogation_Position=2380; Antisense; GGGTGCTGTACGACTTGACAGCCAA
>probe:Drosophila_2:1635718_at:535:303; Interrogation_Position=2409; Antisense; CCGGGCACCACCGAATGGGAATGAT
>probe:Drosophila_2:1635718_at:279:527; Interrogation_Position=2425; Antisense; GGGAATGATGCGTTCAAACCAAAAT
>probe:Drosophila_2:1635718_at:160:623; Interrogation_Position=2492; Antisense; TCAACCAACCAATAAGCGGCGGGCT
>probe:Drosophila_2:1635718_at:209:575; Interrogation_Position=2509; Antisense; GGCGGGCTCTCGATAATAGGACAAT
>probe:Drosophila_2:1635718_at:576:395; Interrogation_Position=2528; Antisense; GACAATGGCCAATCAATGGACGGTC
>probe:Drosophila_2:1635718_at:564:721; Interrogation_Position=2590; Antisense; TTGCCTTCGAGCACTTCACAGCTGC
>probe:Drosophila_2:1635718_at:534:119; Interrogation_Position=2609; Antisense; AGCTGCTCCTGCCTTTTAGAGAGAC
>probe:Drosophila_2:1635718_at:344:177; Interrogation_Position=2639; Antisense; AAACGAGCAATTCATGAGGCGCAAA
>probe:Drosophila_2:1635718_at:624:239; Interrogation_Position=2662; Antisense; AATACAGAACTGCAACTGCCGCTTC
>probe:Drosophila_2:1635718_at:239:283; Interrogation_Position=2671; Antisense; CTGCAACTGCCGCTTCGAAATTTAA
>probe:Drosophila_2:1635718_at:245:541; Interrogation_Position=2706; Antisense; GGTTCTTTATATCGATGATGCACGT
>probe:Drosophila_2:1635718_at:458:73; Interrogation_Position=2815; Antisense; AGGAATGTGCCCACAAACCACGTAA

Paste this into a BLAST search page for me
TGTACGCGATATATCCAAGCTGGATGGGTGCTGTACGACTTGACAGCCAACCGGGCACCACCGAATGGGAATGATGGGAATGATGCGTTCAAACCAAAATTCAACCAACCAATAAGCGGCGGGCTGGCGGGCTCTCGATAATAGGACAATGACAATGGCCAATCAATGGACGGTCTTGCCTTCGAGCACTTCACAGCTGCAGCTGCTCCTGCCTTTTAGAGAGACAAACGAGCAATTCATGAGGCGCAAAAATACAGAACTGCAACTGCCGCTTCCTGCAACTGCCGCTTCGAAATTTAAGGTTCTTTATATCGATGATGCACGTAGGAATGTGCCCACAAACCACGTAA

Full Affymetrix probeset data:

Annotations for 1635718_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime