Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635719_at:

>probe:Drosophila_2:1635719_at:686:395; Interrogation_Position=115; Antisense; GACAAAGTCCCGACTGCCGAAAGTT
>probe:Drosophila_2:1635719_at:520:657; Interrogation_Position=139; Antisense; TAAGGGACACTTGCAATCCTTGCAT
>probe:Drosophila_2:1635719_at:2:251; Interrogation_Position=152; Antisense; CAATCCTTGCATCCGAAGACTCAAT
>probe:Drosophila_2:1635719_at:674:423; Interrogation_Position=219; Antisense; GAGAAAGTCCGTGGCAGATACATCT
>probe:Drosophila_2:1635719_at:25:643; Interrogation_Position=23; Antisense; TCTCTAGTTGATTTACTTGCACACA
>probe:Drosophila_2:1635719_at:233:375; Interrogation_Position=245; Antisense; GAAGAATCAGACTCGCTGCGATCTT
>probe:Drosophila_2:1635719_at:259:605; Interrogation_Position=274; Antisense; TGATCGCTTGCAGTGCTCACAAGAG
>probe:Drosophila_2:1635719_at:101:543; Interrogation_Position=305; Antisense; GGATTGCTTGGTAATAGCCGAGCTT
>probe:Drosophila_2:1635719_at:212:27; Interrogation_Position=318; Antisense; ATAGCCGAGCTTGCTGGGATGCCAA
>probe:Drosophila_2:1635719_at:351:385; Interrogation_Position=346; Antisense; GAACTTAGAAGAATGCCCACCAGCA
>probe:Drosophila_2:1635719_at:12:51; Interrogation_Position=358; Antisense; ATGCCCACCAGCATTGTGATTACCA
>probe:Drosophila_2:1635719_at:10:15; Interrogation_Position=376; Antisense; ATTACCACAAGGGAGCGCAGCTAAA
>probe:Drosophila_2:1635719_at:615:91; Interrogation_Position=69; Antisense; AGTATTATCTGCGTCATCTTGTTCC
>probe:Drosophila_2:1635719_at:55:37; Interrogation_Position=84; Antisense; ATCTTGTTCCTTGGCTGTGTACTTA

Paste this into a BLAST search page for me
GACAAAGTCCCGACTGCCGAAAGTTTAAGGGACACTTGCAATCCTTGCATCAATCCTTGCATCCGAAGACTCAATGAGAAAGTCCGTGGCAGATACATCTTCTCTAGTTGATTTACTTGCACACAGAAGAATCAGACTCGCTGCGATCTTTGATCGCTTGCAGTGCTCACAAGAGGGATTGCTTGGTAATAGCCGAGCTTATAGCCGAGCTTGCTGGGATGCCAAGAACTTAGAAGAATGCCCACCAGCAATGCCCACCAGCATTGTGATTACCAATTACCACAAGGGAGCGCAGCTAAAAGTATTATCTGCGTCATCTTGTTCCATCTTGTTCCTTGGCTGTGTACTTA

Full Affymetrix probeset data:

Annotations for 1635719_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime