Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635723_s_at:

>probe:Drosophila_2:1635723_s_at:407:587; Interrogation_Position=268; Antisense; TGGACCTTGGGTAGCATCTTCATCA
>probe:Drosophila_2:1635723_s_at:629:7; Interrogation_Position=301; Antisense; ATTGCCGGAGCTCTGTACTACGATA
>probe:Drosophila_2:1635723_s_at:136:41; Interrogation_Position=357; Antisense; ATCGGCCACCGGCAAGGTGCTGAAA
>probe:Drosophila_2:1635723_s_at:650:549; Interrogation_Position=388; Antisense; GGAGTCCTGCCGCATGTCCAGAAGT
>probe:Drosophila_2:1635723_s_at:9:111; Interrogation_Position=407; Antisense; AGAAGTCCTGGTACACGGTCATGGG
>probe:Drosophila_2:1635723_s_at:75:563; Interrogation_Position=459; Antisense; GGAAGTGAATGTGCCGCCGTACGCC
>probe:Drosophila_2:1635723_s_at:332:187; Interrogation_Position=553; Antisense; AACGGCAAGGGATACTTTGGCGCCA
>probe:Drosophila_2:1635723_s_at:516:411; Interrogation_Position=581; Antisense; GGCCCGTTGTGGCAAAGTTCATTGA
>probe:Drosophila_2:1635723_s_at:369:27; Interrogation_Position=609; Antisense; ATACGTGCCCAATTCGTCTGGCAAA
>probe:Drosophila_2:1635723_s_at:506:183; Interrogation_Position=631; Antisense; AAAATCGAAGCTTTTGCCGCTGGCG
>probe:Drosophila_2:1635723_s_at:305:327; Interrogation_Position=653; Antisense; GCGTTAGCGATTTAGCCGCCAGCAG
>probe:Drosophila_2:1635723_s_at:539:387; Interrogation_Position=682; Antisense; GAAAAGGCTGCAGCGCTCATCAAGG
>probe:Drosophila_2:1635723_s_at:1:185; Interrogation_Position=707; Antisense; AAAAGGTGCTTGTTGGCCGTCTCTC
>probe:Drosophila_2:1635723_s_at:533:181; Interrogation_Position=803; Antisense; AAAAGGTCGACGCATACGCCAAGCT

Paste this into a BLAST search page for me
TGGACCTTGGGTAGCATCTTCATCAATTGCCGGAGCTCTGTACTACGATAATCGGCCACCGGCAAGGTGCTGAAAGGAGTCCTGCCGCATGTCCAGAAGTAGAAGTCCTGGTACACGGTCATGGGGGAAGTGAATGTGCCGCCGTACGCCAACGGCAAGGGATACTTTGGCGCCAGGCCCGTTGTGGCAAAGTTCATTGAATACGTGCCCAATTCGTCTGGCAAAAAAATCGAAGCTTTTGCCGCTGGCGGCGTTAGCGATTTAGCCGCCAGCAGGAAAAGGCTGCAGCGCTCATCAAGGAAAAGGTGCTTGTTGGCCGTCTCTCAAAAGGTCGACGCATACGCCAAGCT

Full Affymetrix probeset data:

Annotations for 1635723_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime