FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635724_at:

>probe:Drosophila_2:1635724_at:105:523; Interrogation_Position=115; Antisense; GGGCCCTGGAGCTACTGTTGGAAAT
>probe:Drosophila_2:1635724_at:519:665; Interrogation_Position=127; Antisense; TACTGTTGGAAATCCCCTTGCCGGA
>probe:Drosophila_2:1635724_at:94:581; Interrogation_Position=184; Antisense; TGCCTTTAATCCCTTCCTAAATGGA
>probe:Drosophila_2:1635724_at:536:19; Interrogation_Position=290; Antisense; ATTTCCTCATTCTTCCAGTCGATAG
>probe:Drosophila_2:1635724_at:314:457; Interrogation_Position=310; Antisense; GATAGTCCTGCAACGCGAAGCCGAG
>probe:Drosophila_2:1635724_at:38:551; Interrogation_Position=406; Antisense; GGAGTCGATCAGTGGCTGCAACAAC
>probe:Drosophila_2:1635724_at:107:723; Interrogation_Position=437; Antisense; TTGCCCTGGCTGCAGATACGCTGTG
>probe:Drosophila_2:1635724_at:427:27; Interrogation_Position=452; Antisense; ATACGCTGTGTCAAGCCTCTGCTGA
>probe:Drosophila_2:1635724_at:364:211; Interrogation_Position=485; Antisense; AAGAACCAGCTGAAGGCCATCGATG
>probe:Drosophila_2:1635724_at:103:113; Interrogation_Position=553; Antisense; AGCAGCTGCTGCCTAGGATTCTAGT
>probe:Drosophila_2:1635724_at:581:623; Interrogation_Position=591; Antisense; TGCCTTAGTGTCCAATACTTCCTAG
>probe:Drosophila_2:1635724_at:89:631; Interrogation_Position=610; Antisense; TCCTAGCTTAGCAATCGACCAACAT
>probe:Drosophila_2:1635724_at:670:9; Interrogation_Position=67; Antisense; ATTCGCAATTGTTCTACTGGCGGCC
>probe:Drosophila_2:1635724_at:154:117; Interrogation_Position=92; Antisense; AGCATTGCCTGCATCAGTGCACAGG

Paste this into a BLAST search page for me
GGGCCCTGGAGCTACTGTTGGAAATTACTGTTGGAAATCCCCTTGCCGGATGCCTTTAATCCCTTCCTAAATGGAATTTCCTCATTCTTCCAGTCGATAGGATAGTCCTGCAACGCGAAGCCGAGGGAGTCGATCAGTGGCTGCAACAACTTGCCCTGGCTGCAGATACGCTGTGATACGCTGTGTCAAGCCTCTGCTGAAAGAACCAGCTGAAGGCCATCGATGAGCAGCTGCTGCCTAGGATTCTAGTTGCCTTAGTGTCCAATACTTCCTAGTCCTAGCTTAGCAATCGACCAACATATTCGCAATTGTTCTACTGGCGGCCAGCATTGCCTGCATCAGTGCACAGG

Full Affymetrix probeset data:

Annotations for 1635724_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720