Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635730_at:

>probe:Drosophila_2:1635730_at:683:613; Interrogation_Position=10511; Antisense; TGAAGAACTCATCCTCAATGACCCG
>probe:Drosophila_2:1635730_at:306:609; Interrogation_Position=10529; Antisense; TGACCCGCATCATTTCTGGTGGAAC
>probe:Drosophila_2:1635730_at:31:199; Interrogation_Position=10571; Antisense; AACGATCAACGGTGACACGCAGCCA
>probe:Drosophila_2:1635730_at:171:157; Interrogation_Position=10585; Antisense; ACACGCAGCCATGTTTCGGGTGGTG
>probe:Drosophila_2:1635730_at:542:521; Interrogation_Position=10607; Antisense; GTGGCGGCATTGATTTTTCGTCTCA
>probe:Drosophila_2:1635730_at:162:17; Interrogation_Position=10619; Antisense; ATTTTTCGTCTCAATCACATTCCCA
>probe:Drosophila_2:1635730_at:320:563; Interrogation_Position=10648; Antisense; GGAAGCCATACCAGCCGACATCGAG
>probe:Drosophila_2:1635730_at:259:165; Interrogation_Position=10677; Antisense; AAATCAGCAGGTGTCCAGCTTGGGC
>probe:Drosophila_2:1635730_at:587:513; Interrogation_Position=10751; Antisense; GTGTGGTAACCCGTCGAGGAAATCA
>probe:Drosophila_2:1635730_at:567:33; Interrogation_Position=10772; Antisense; ATCAGTCCTCAATTAGTCTGGGCAA
>probe:Drosophila_2:1635730_at:598:477; Interrogation_Position=10803; Antisense; GTTTACCGGCTCCAGTTTGTACAAG
>probe:Drosophila_2:1635730_at:544:29; Interrogation_Position=10837; Antisense; ATAACTGCCCCAAAAACGACGTGTG
>probe:Drosophila_2:1635730_at:127:187; Interrogation_Position=10877; Antisense; AACAAGGTGCATTCCAACATACAAG
>probe:Drosophila_2:1635730_at:576:661; Interrogation_Position=10939; Antisense; TAACACAGCCCGACTACGAGTATAT

Paste this into a BLAST search page for me
TGAAGAACTCATCCTCAATGACCCGTGACCCGCATCATTTCTGGTGGAACAACGATCAACGGTGACACGCAGCCAACACGCAGCCATGTTTCGGGTGGTGGTGGCGGCATTGATTTTTCGTCTCAATTTTTCGTCTCAATCACATTCCCAGGAAGCCATACCAGCCGACATCGAGAAATCAGCAGGTGTCCAGCTTGGGCGTGTGGTAACCCGTCGAGGAAATCAATCAGTCCTCAATTAGTCTGGGCAAGTTTACCGGCTCCAGTTTGTACAAGATAACTGCCCCAAAAACGACGTGTGAACAAGGTGCATTCCAACATACAAGTAACACAGCCCGACTACGAGTATAT

Full Affymetrix probeset data:

Annotations for 1635730_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime