FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635731_at:

>probe:Drosophila_2:1635731_at:686:97; Interrogation_Position=3449; Antisense; AGATCGGTGCGTGGACTGCGCCAAA
>probe:Drosophila_2:1635731_at:579:671; Interrogation_Position=3557; Antisense; TACGATTTCGTCATCACGGAGGGCT
>probe:Drosophila_2:1635731_at:32:141; Interrogation_Position=3572; Antisense; ACGGAGGGCTCCTACAAGTTCTGGG
>probe:Drosophila_2:1635731_at:631:215; Interrogation_Position=3587; Antisense; AAGTTCTGGGCCGTCTTTCAGGTGG
>probe:Drosophila_2:1635731_at:146:619; Interrogation_Position=3621; Antisense; TGCTGATTATCTACTCGACGTTCGC
>probe:Drosophila_2:1635731_at:549:335; Interrogation_Position=3644; Antisense; GCTGCCATTTACTACTCCAAGGTGA
>probe:Drosophila_2:1635731_at:679:221; Interrogation_Position=3662; Antisense; AAGGTGAATCCGCTGACCAGTGATT
>probe:Drosophila_2:1635731_at:169:451; Interrogation_Position=3698; Antisense; GATTACCTGGGTGGAGTTCGTTCGT
>probe:Drosophila_2:1635731_at:349:89; Interrogation_Position=3712; Antisense; AGTTCGTTCGTTGTCCGGCGGAGAT
>probe:Drosophila_2:1635731_at:373:589; Interrogation_Position=3747; Antisense; TGGATGACGGCGATGCAGCGACACC
>probe:Drosophila_2:1635731_at:250:577; Interrogation_Position=3817; Antisense; GGCGCATTCCATCCAGTTTATACTG
>probe:Drosophila_2:1635731_at:531:627; Interrogation_Position=3844; Antisense; TGCCATCGACAAGGTGCCAGTGGAT
>probe:Drosophila_2:1635731_at:74:157; Interrogation_Position=3912; Antisense; ACACGCCGGCGCTGGGAATGAGATA
>probe:Drosophila_2:1635731_at:344:527; Interrogation_Position=3937; Antisense; GGGAACTGACTACCATATGCGATAT

Paste this into a BLAST search page for me
AGATCGGTGCGTGGACTGCGCCAAATACGATTTCGTCATCACGGAGGGCTACGGAGGGCTCCTACAAGTTCTGGGAAGTTCTGGGCCGTCTTTCAGGTGGTGCTGATTATCTACTCGACGTTCGCGCTGCCATTTACTACTCCAAGGTGAAAGGTGAATCCGCTGACCAGTGATTGATTACCTGGGTGGAGTTCGTTCGTAGTTCGTTCGTTGTCCGGCGGAGATTGGATGACGGCGATGCAGCGACACCGGCGCATTCCATCCAGTTTATACTGTGCCATCGACAAGGTGCCAGTGGATACACGCCGGCGCTGGGAATGAGATAGGGAACTGACTACCATATGCGATAT

Full Affymetrix probeset data:

Annotations for 1635731_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720