FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635736_at:

>probe:Drosophila_2:1635736_at:501:441; Interrogation_Position=103; Antisense; GATGTAACCAAGTTCCTCGGCGAGC
>probe:Drosophila_2:1635736_at:524:347; Interrogation_Position=126; Antisense; GCATCCTGGCGGCAGTGAAGCACTA
>probe:Drosophila_2:1635736_at:33:61; Interrogation_Position=13; Antisense; ATGTCACAGTTGTACGAACTCTCGG
>probe:Drosophila_2:1635736_at:400:209; Interrogation_Position=143; Antisense; AAGCACTACTCGAATATGGCGGCAA
>probe:Drosophila_2:1635736_at:398:579; Interrogation_Position=196; Antisense; GGCCATTCCTCCGACGCAGAAAAGG
>probe:Drosophila_2:1635736_at:103:695; Interrogation_Position=22; Antisense; TTGTACGAACTCTCGGAGGTGGCCC
>probe:Drosophila_2:1635736_at:609:423; Interrogation_Position=242; Antisense; GAGAAATCAACTCAGCTGCACCCAT
>probe:Drosophila_2:1635736_at:565:271; Interrogation_Position=264; Antisense; CATTCAAGTGCAGCCAACGTCCAAT
>probe:Drosophila_2:1635736_at:620:139; Interrogation_Position=280; Antisense; ACGTCCAATGGTGCAGCAAAGCCGA
>probe:Drosophila_2:1635736_at:157:23; Interrogation_Position=316; Antisense; ATATCCGAAGATCCCGAACCCGCGA
>probe:Drosophila_2:1635736_at:643:375; Interrogation_Position=339; Antisense; GAAGAATAGCTCCTCCGGTTTCTGT
>probe:Drosophila_2:1635736_at:440:531; Interrogation_Position=39; Antisense; GGTGGCCCAGCAGAACGGCAAGAAT
>probe:Drosophila_2:1635736_at:114:211; Interrogation_Position=58; Antisense; AAGAATGGCAAACCCTGCTGGCTGA
>probe:Drosophila_2:1635736_at:78:177; Interrogation_Position=67; Antisense; AAACCCTGCTGGCTGATCATCAAGG

Paste this into a BLAST search page for me
GATGTAACCAAGTTCCTCGGCGAGCGCATCCTGGCGGCAGTGAAGCACTAATGTCACAGTTGTACGAACTCTCGGAAGCACTACTCGAATATGGCGGCAAGGCCATTCCTCCGACGCAGAAAAGGTTGTACGAACTCTCGGAGGTGGCCCGAGAAATCAACTCAGCTGCACCCATCATTCAAGTGCAGCCAACGTCCAATACGTCCAATGGTGCAGCAAAGCCGAATATCCGAAGATCCCGAACCCGCGAGAAGAATAGCTCCTCCGGTTTCTGTGGTGGCCCAGCAGAACGGCAAGAATAAGAATGGCAAACCCTGCTGGCTGAAAACCCTGCTGGCTGATCATCAAGG

Full Affymetrix probeset data:

Annotations for 1635736_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720