FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635737_at:

>probe:Drosophila_2:1635737_at:246:333; Interrogation_Position=3870; Antisense; GCTGTCCTCTTTTTGACTTTGCTAT
>probe:Drosophila_2:1635737_at:670:583; Interrogation_Position=3895; Antisense; TGGCATTTGTGCGATCTGCGATCAT
>probe:Drosophila_2:1635737_at:444:327; Interrogation_Position=3912; Antisense; GCGATCATCCATGCGCCAAGTAGCA
>probe:Drosophila_2:1635737_at:505:103; Interrogation_Position=3955; Antisense; AGACTCGCAACTGATGTGCGTCCAT
>probe:Drosophila_2:1635737_at:107:505; Interrogation_Position=3970; Antisense; GTGCGTCCATCCGAAGAACAAGGCC
>probe:Drosophila_2:1635737_at:56:173; Interrogation_Position=3996; Antisense; AAAGCTTGAGGCTTTCCATCTTCGA
>probe:Drosophila_2:1635737_at:329:441; Interrogation_Position=4019; Antisense; GATGGAACGCATCCTTTGCGAGTGT
>probe:Drosophila_2:1635737_at:94:269; Interrogation_Position=4062; Antisense; CATGGAGCGCTCAAAGTGAACACTT
>probe:Drosophila_2:1635737_at:92:359; Interrogation_Position=4094; Antisense; GCAAAAGCCCGACGCTTTCGAGTTA
>probe:Drosophila_2:1635737_at:152:547; Interrogation_Position=4111; Antisense; TCGAGTTATACCACGAACCCATTAA
>probe:Drosophila_2:1635737_at:541:391; Interrogation_Position=4150; Antisense; GAAAGCATTGTGTGCACTTCAGTCT
>probe:Drosophila_2:1635737_at:57:149; Interrogation_Position=4165; Antisense; ACTTCAGTCTTCAGGTTTGACCTTG
>probe:Drosophila_2:1635737_at:599:491; Interrogation_Position=4325; Antisense; GTAAAAACTTGCTGACTCCTTGTGT
>probe:Drosophila_2:1635737_at:150:283; Interrogation_Position=4340; Antisense; CTCCTTGTGTCATCGGTTCTGAAGA

Paste this into a BLAST search page for me
GCTGTCCTCTTTTTGACTTTGCTATTGGCATTTGTGCGATCTGCGATCATGCGATCATCCATGCGCCAAGTAGCAAGACTCGCAACTGATGTGCGTCCATGTGCGTCCATCCGAAGAACAAGGCCAAAGCTTGAGGCTTTCCATCTTCGAGATGGAACGCATCCTTTGCGAGTGTCATGGAGCGCTCAAAGTGAACACTTGCAAAAGCCCGACGCTTTCGAGTTATCGAGTTATACCACGAACCCATTAAGAAAGCATTGTGTGCACTTCAGTCTACTTCAGTCTTCAGGTTTGACCTTGGTAAAAACTTGCTGACTCCTTGTGTCTCCTTGTGTCATCGGTTCTGAAGA

Full Affymetrix probeset data:

Annotations for 1635737_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720