Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635738_at:

>probe:Drosophila_2:1635738_at:563:317; Interrogation_Position=2407; Antisense; GCGCGGGAGTTGTTTGTTGCAAACT
>probe:Drosophila_2:1635738_at:667:463; Interrogation_Position=2449; Antisense; GATTCCAAAAACTGAATGTGCCTCA
>probe:Drosophila_2:1635738_at:405:101; Interrogation_Position=2518; Antisense; AGCATCAGATTATACCCAACTACGA
>probe:Drosophila_2:1635738_at:333:669; Interrogation_Position=2530; Antisense; TACCCAACTACGATTCAGTGTTTGT
>probe:Drosophila_2:1635738_at:421:495; Interrogation_Position=2571; Antisense; GTCCAATTTTACACACCTAGGCTAG
>probe:Drosophila_2:1635738_at:336:545; Interrogation_Position=2595; Antisense; GGATGATTTTTACACACACCGAATT
>probe:Drosophila_2:1635738_at:633:155; Interrogation_Position=2610; Antisense; ACACCGAATTGATTTAGCGCACCAT
>probe:Drosophila_2:1635738_at:64:461; Interrogation_Position=2620; Antisense; GATTTAGCGCACCATGATGCAACCA
>probe:Drosophila_2:1635738_at:274:607; Interrogation_Position=2634; Antisense; TGATGCAACCAACTGACCGATCCGA
>probe:Drosophila_2:1635738_at:154:413; Interrogation_Position=2648; Antisense; GACCGATCCGACGAGAAACATTTCA
>probe:Drosophila_2:1635738_at:703:229; Interrogation_Position=2716; Antisense; AATGGGCACGGGTGATGCGCACACA
>probe:Drosophila_2:1635738_at:216:51; Interrogation_Position=2730; Antisense; ATGCGCACACAAATCGAAATTCGAA
>probe:Drosophila_2:1635738_at:418:343; Interrogation_Position=2778; Antisense; GCTTCCAAAGCTTCCAAACCAAATG
>probe:Drosophila_2:1635738_at:459:679; Interrogation_Position=2860; Antisense; TAGTCCTAGACATTGAGTGTACGAT

Paste this into a BLAST search page for me
GCGCGGGAGTTGTTTGTTGCAAACTGATTCCAAAAACTGAATGTGCCTCAAGCATCAGATTATACCCAACTACGATACCCAACTACGATTCAGTGTTTGTGTCCAATTTTACACACCTAGGCTAGGGATGATTTTTACACACACCGAATTACACCGAATTGATTTAGCGCACCATGATTTAGCGCACCATGATGCAACCATGATGCAACCAACTGACCGATCCGAGACCGATCCGACGAGAAACATTTCAAATGGGCACGGGTGATGCGCACACAATGCGCACACAAATCGAAATTCGAAGCTTCCAAAGCTTCCAAACCAAATGTAGTCCTAGACATTGAGTGTACGAT

Full Affymetrix probeset data:

Annotations for 1635738_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime